ID: 1075375410

View in Genome Browser
Species Human (GRCh38)
Location 10:121974790-121974812
Sequence GCGCGGGGGGAGGGCACCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 417}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075375410_1075375423 -7 Left 1075375410 10:121974790-121974812 CCTCCGGTGCCCTCCCCCCGCGC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1075375423 10:121974806-121974828 CCCGCGCCCGGCGCAGGGCGGGG 0: 1
1: 0
2: 8
3: 49
4: 381
1075375410_1075375421 -8 Left 1075375410 10:121974790-121974812 CCTCCGGTGCCCTCCCCCCGCGC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1075375421 10:121974805-121974827 CCCCGCGCCCGGCGCAGGGCGGG 0: 1
1: 0
2: 9
3: 57
4: 530
1075375410_1075375433 27 Left 1075375410 10:121974790-121974812 CCTCCGGTGCCCTCCCCCCGCGC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1075375433 10:121974840-121974862 TCCGGGCCCGCGCCGCCCGGAGG 0: 1
1: 0
2: 1
3: 24
4: 233
1075375410_1075375432 24 Left 1075375410 10:121974790-121974812 CCTCCGGTGCCCTCCCCCCGCGC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1075375432 10:121974837-121974859 CCGTCCGGGCCCGCGCCGCCCGG 0: 1
1: 0
2: 1
3: 30
4: 242
1075375410_1075375427 0 Left 1075375410 10:121974790-121974812 CCTCCGGTGCCCTCCCCCCGCGC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1075375427 10:121974813-121974835 CCGGCGCAGGGCGGGGACAGCGG 0: 1
1: 0
2: 3
3: 46
4: 441
1075375410_1075375429 10 Left 1075375410 10:121974790-121974812 CCTCCGGTGCCCTCCCCCCGCGC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1075375429 10:121974823-121974845 GCGGGGACAGCGGCCCGTCCGGG 0: 1
1: 0
2: 0
3: 19
4: 226
1075375410_1075375419 -9 Left 1075375410 10:121974790-121974812 CCTCCGGTGCCCTCCCCCCGCGC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1075375419 10:121974804-121974826 CCCCCGCGCCCGGCGCAGGGCGG 0: 1
1: 0
2: 6
3: 64
4: 471
1075375410_1075375428 9 Left 1075375410 10:121974790-121974812 CCTCCGGTGCCCTCCCCCCGCGC 0: 1
1: 0
2: 3
3: 42
4: 417
Right 1075375428 10:121974822-121974844 GGCGGGGACAGCGGCCCGTCCGG 0: 1
1: 0
2: 0
3: 16
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075375410 Original CRISPR GCGCGGGGGGAGGGCACCGG AGG (reversed) Intronic