ID: 1075380458

View in Genome Browser
Species Human (GRCh38)
Location 10:122014575-122014597
Sequence TATAAAATGGGGCATCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075380445_1075380458 14 Left 1075380445 10:122014538-122014560 CCTTAGCTCCCTGCCCCTCTCCA 0: 1
1: 1
2: 9
3: 87
4: 817
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380450_1075380458 -1 Left 1075380450 10:122014553-122014575 CCTCTCCACCCCATGCTCAGTGT 0: 1
1: 0
2: 3
3: 37
4: 387
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380448_1075380458 1 Left 1075380448 10:122014551-122014573 CCCCTCTCCACCCCATGCTCAGT 0: 1
1: 0
2: 2
3: 47
4: 522
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380452_1075380458 -9 Left 1075380452 10:122014561-122014583 CCCCATGCTCAGTGTATAAAATG 0: 1
1: 1
2: 2
3: 12
4: 197
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380453_1075380458 -10 Left 1075380453 10:122014562-122014584 CCCATGCTCAGTGTATAAAATGG 0: 1
1: 1
2: 0
3: 14
4: 166
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380444_1075380458 20 Left 1075380444 10:122014532-122014554 CCGATTCCTTAGCTCCCTGCCCC 0: 1
1: 1
2: 18
3: 137
4: 932
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380447_1075380458 5 Left 1075380447 10:122014547-122014569 CCTGCCCCTCTCCACCCCATGCT 0: 1
1: 0
2: 8
3: 115
4: 1045
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380449_1075380458 0 Left 1075380449 10:122014552-122014574 CCCTCTCCACCCCATGCTCAGTG 0: 1
1: 0
2: 1
3: 53
4: 484
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380451_1075380458 -6 Left 1075380451 10:122014558-122014580 CCACCCCATGCTCAGTGTATAAA 0: 1
1: 0
2: 0
3: 8
4: 148
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data
1075380446_1075380458 6 Left 1075380446 10:122014546-122014568 CCCTGCCCCTCTCCACCCCATGC 0: 1
1: 0
2: 15
3: 117
4: 1032
Right 1075380458 10:122014575-122014597 TATAAAATGGGGCATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075380458 Original CRISPR TATAAAATGGGGCATCAGCC TGG Intronic
No off target data available for this crispr