ID: 1075383145

View in Genome Browser
Species Human (GRCh38)
Location 10:122035047-122035069
Sequence TCCAACCTGCCACTGACTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075383145_1075383148 -3 Left 1075383145 10:122035047-122035069 CCATAAGTCAGTGGCAGGTTGGA 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1075383148 10:122035067-122035089 GGAGACAAGAAGCCATCTTGGGG No data
1075383145_1075383151 11 Left 1075383145 10:122035047-122035069 CCATAAGTCAGTGGCAGGTTGGA 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1075383151 10:122035081-122035103 ATCTTGGGGGATCCTAGTCCAGG No data
1075383145_1075383149 -2 Left 1075383145 10:122035047-122035069 CCATAAGTCAGTGGCAGGTTGGA 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1075383149 10:122035068-122035090 GAGACAAGAAGCCATCTTGGGGG No data
1075383145_1075383152 20 Left 1075383145 10:122035047-122035069 CCATAAGTCAGTGGCAGGTTGGA 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1075383152 10:122035090-122035112 GATCCTAGTCCAGGCTCCTACGG No data
1075383145_1075383153 21 Left 1075383145 10:122035047-122035069 CCATAAGTCAGTGGCAGGTTGGA 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1075383153 10:122035091-122035113 ATCCTAGTCCAGGCTCCTACGGG No data
1075383145_1075383146 -5 Left 1075383145 10:122035047-122035069 CCATAAGTCAGTGGCAGGTTGGA 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1075383146 10:122035065-122035087 TTGGAGACAAGAAGCCATCTTGG No data
1075383145_1075383147 -4 Left 1075383145 10:122035047-122035069 CCATAAGTCAGTGGCAGGTTGGA 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1075383147 10:122035066-122035088 TGGAGACAAGAAGCCATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075383145 Original CRISPR TCCAACCTGCCACTGACTTA TGG (reversed) Intronic
905772615 1:40648150-40648172 TCCAACCTCCCTCTGATTAATGG + Intronic
906041938 1:42794275-42794297 TTCAGCCTGCCACTGCCTTTGGG + Intronic
906676700 1:47698397-47698419 TCCACTCTGACACTGACCTAGGG - Intergenic
910665963 1:89726201-89726223 TCCCACCTCCAACTGCCTTATGG + Intronic
911541923 1:99166573-99166595 TCCAAGCTGCCATTGTTTTAGGG - Intergenic
912173058 1:107124146-107124168 TCCATCCTGCCACTGAATGGGGG - Intergenic
913314087 1:117535355-117535377 TACACCCTGCCTCTGACTGACGG + Intergenic
913701899 1:121382313-121382335 TACAACCTGCCACTCACTGAGGG - Intronic
914042458 1:144062782-144062804 TACAACCTGCCACTCACTGAGGG - Intergenic
916375713 1:164151218-164151240 GCCAACCTGGCACTGAGCTATGG - Intergenic
917459059 1:175212607-175212629 TCAAATCTGCAAATGACTTAGGG - Intergenic
919560531 1:199113421-199113443 TCCAGGCTGCCACTGACATCTGG - Intergenic
919747503 1:201017736-201017758 TCCCACCTGAGGCTGACTTAAGG - Intronic
920489322 1:206401033-206401055 TACAACCTGCCACTCACTGAGGG - Intronic
923956685 1:239030546-239030568 TCCAACCTGACTCTGGCATAAGG - Intergenic
1063994166 10:11601395-11601417 TCCATCCTACCACTGGCTTGAGG - Intronic
1064624292 10:17246568-17246590 TCTAAACTGTGACTGACTTAAGG - Intergenic
1065681883 10:28244193-28244215 TCCTATCTGCTAGTGACTTAAGG + Intronic
1067566450 10:47341272-47341294 TCGAACCAGCCACTCATTTATGG - Intergenic
1073113825 10:101079730-101079752 TCCACCCTCCCACTCACTCAAGG - Intergenic
1073376574 10:103040467-103040489 TCCCACCAGCTACTGAATTAAGG - Intronic
1075383145 10:122035047-122035069 TCCAACCTGCCACTGACTTATGG - Intronic
1075511781 10:123078329-123078351 TCCATCCTGCAACTGACTCTAGG - Intergenic
1077547633 11:3182392-3182414 TCCAACCGGACACTCACTCAAGG - Intergenic
1078868069 11:15316920-15316942 TCAAAGCTACCATTGACTTAAGG + Intergenic
1084057431 11:66644905-66644927 CCCAGCCTGTCACTTACTTAGGG + Intronic
1085587740 11:77727228-77727250 TACAACCTGCTTCTAACTTAAGG + Intronic
1086068896 11:82776815-82776837 TCCAACCTGTGACTGCTTTAGGG - Intergenic
1088915545 11:114225105-114225127 TCCAACTCCCCACTGACTTCTGG - Intronic
1090173450 11:124625747-124625769 TCCAGTTTGCCCCTGACTTATGG + Exonic
1091150279 11:133322231-133322253 TCTAAGCAGCCACTGACTGATGG + Intronic
1099051816 12:77789938-77789960 TCCAACCTGCCACCCACATTCGG - Intergenic
1099257186 12:80328371-80328393 TCCACATTTCCACTGACTTATGG + Intronic
1100599039 12:96097054-96097076 TCCAGCATGCCCCTGCCTTAAGG - Intergenic
1101642264 12:106595602-106595624 TCCCACCTGCCAGTTACTTTGGG + Intronic
1101856974 12:108451905-108451927 TCCACCCTGACATTGGCTTATGG + Intergenic
1102624629 12:114225179-114225201 TCCAGCCTGCCACTGATCTGGGG + Intergenic
1107110531 13:36692741-36692763 TCCTATCTGCCACTTACTTTGGG - Intronic
1113879409 13:113615389-113615411 TCCACCCTGCCCCTGTCTGAGGG + Intronic
1122022782 14:98853218-98853240 TCCATCCAGGCACTGACTGAGGG + Intergenic
1123713616 15:23010299-23010321 TTGAAGTTGCCACTGACTTAGGG + Intronic
1124880231 15:33635417-33635439 TACAAGCTACCACTGACTGAGGG - Intronic
1126771164 15:52057430-52057452 ACCAACCTGCCTCTGTCTTCTGG + Intronic
1129927400 15:79376936-79376958 CCCCACCTCCCACTGACTGAAGG - Intronic
1137928651 16:52565609-52565631 TACAACATTCCTCTGACTTATGG - Intergenic
1137984814 16:53098991-53099013 TCCAGCCTGGCTCTGACTCATGG + Intronic
1138938451 16:61759919-61759941 TCAAACCTGCCATTTTCTTAAGG - Intronic
1140956317 16:79869724-79869746 TCCAACCTGCCACTGCCCAGAGG + Intergenic
1141170211 16:81686205-81686227 TCCCACCTGTCCCTGACTCATGG - Intronic
1153612363 18:6899401-6899423 TCCAACCTGCAACTGACAACAGG + Intronic
1157763228 18:50280347-50280369 TCCTCCCTGTCACTGACCTAAGG + Intronic
927119400 2:19941064-19941086 TCCAAATTGCCACTAACTTCTGG + Intronic
930133545 2:47878033-47878055 GCCTACCTGCCCATGACTTAGGG - Intronic
931017013 2:57993873-57993895 TCCAACCTGCCCCTGTCTCCAGG - Intronic
933595014 2:84274523-84274545 TAACACCTGCCACTGACTCAGGG - Intergenic
936838193 2:116734021-116734043 GCCAAGCTGCCAATGACTTTCGG + Intergenic
941875518 2:170428879-170428901 CCACACCTGCCACTGACTTAAGG - Intronic
948332732 2:237182896-237182918 TCCTACCCGCCATTGGCTTAGGG + Intergenic
948815376 2:240507636-240507658 CCCAACCTGCCCCTGACCAAAGG - Exonic
1170286686 20:14717728-14717750 TCCAACATCCCACTGACTCAAGG - Intronic
1170486232 20:16818815-16818837 TCCCACCTACCACTGTCCTAAGG + Intergenic
1174531615 20:51219061-51219083 TCCAACCTCACACTGCCTTCTGG - Intergenic
1176431576 21:6579373-6579395 TCCACCCTGCCACTGGCCCAGGG - Intergenic
1179418225 21:41215313-41215335 TCCAAGCTGCCAGAGACCTAAGG - Intronic
1179706970 21:43186835-43186857 TCCACCCTGCCACTGGCCCAGGG - Intergenic
1179973167 21:44847516-44847538 TCCATCCTGTCACTGGCTTCGGG - Intergenic
1182322476 22:29487126-29487148 TCAAGGCTGCCACTGACTAAGGG - Intronic
1185187783 22:49413236-49413258 ACCAACCTGCAACTGAATTTTGG - Intergenic
952872813 3:37916921-37916943 CCCAAACTGCCAGTGACTCATGG - Intronic
954554497 3:51507255-51507277 TCCAGGCTGCCCCTGACTTCTGG - Intergenic
957661820 3:83166200-83166222 TCCAACCTGCGACTTCCTCAGGG + Intergenic
961074183 3:123966300-123966322 CCCCACCTGTCACTGACTGAGGG - Intergenic
961236633 3:125373786-125373808 TCCCACCAGCCACAGATTTATGG + Intronic
966097595 3:176223053-176223075 TCCAAGCTGATTCTGACTTACGG - Intergenic
967571016 3:191028342-191028364 TCCAAACTGACACTAAATTAAGG - Intergenic
969102414 4:4779015-4779037 ACCAACCTGCCAAGGATTTAAGG - Intergenic
969179055 4:5423598-5423620 TCCAACATTCCCCTGCCTTATGG + Intronic
972359230 4:38311976-38311998 TCAAACCTTCCTCTGACATACGG - Intergenic
979118405 4:116859084-116859106 TCCAACCTGTCAGTGACATTTGG + Intergenic
982399971 4:154955134-154955156 TCCAACCTACCTTTGACTTTTGG - Intergenic
985808870 5:2068670-2068692 TCCCACCCTCCACTGACTCACGG - Intergenic
992317254 5:75569175-75569197 TCCACCCATCCACTTACTTATGG - Intronic
996414392 5:123194546-123194568 TCCAGCCTGCCACAGATTTGTGG - Intergenic
996531517 5:124532522-124532544 TGCAACCTCACACTGACTTAAGG + Intergenic
1004947409 6:20630760-20630782 TCCATCCTGGCACTGCCTTCTGG + Intronic
1007452058 6:41947689-41947711 TCCAACCTGCGACCCACTTCTGG + Intronic
1009910449 6:69919059-69919081 CCCAAACTCCCACTGCCTTAAGG + Intronic
1014255395 6:119156150-119156172 TCCTTCCTGCCACTGGGTTATGG + Intergenic
1014506425 6:122265022-122265044 TCCAACTTGGCACTAACATAGGG - Intergenic
1018681722 6:166270715-166270737 TCCAAGTGTCCACTGACTTAGGG - Intergenic
1023298439 7:38741061-38741083 TCCACCCTGCCTCTTACCTAAGG + Intronic
1024724332 7:52175650-52175672 TACAACTTGCCTCTGTCTTATGG - Intergenic
1028505677 7:91567904-91567926 TCCTACCTTCCCCTGACTAAAGG + Intergenic
1029903482 7:104067177-104067199 TCCCACCTGCCATTGATTTATGG - Intergenic
1030130255 7:106193795-106193817 TCCCTCCTTCCACTGACTGAGGG + Intergenic
1030250424 7:107437966-107437988 TCCAATCTGTCAAAGACTTATGG + Intronic
1032485034 7:132279303-132279325 TCCAACCTGTCACTATGTTAAGG - Intronic
1034992808 7:155558868-155558890 CCCAACTTGCCACTGACATTGGG + Intergenic
1035036911 7:155901527-155901549 ACCCTCCTGCCACTGACTTAGGG - Intergenic
1037825963 8:22160769-22160791 TCAAATCTGCCAATGACTTTGGG - Intronic
1043008079 8:74845492-74845514 TCCAACCTGGTACTTACTTTGGG - Exonic
1045420714 8:102012130-102012152 ACCAGTTTGCCACTGACTTAAGG - Intronic
1048523588 8:135180103-135180125 TCCAACAGGCCACTCACTAATGG - Intergenic
1051252517 9:15175898-15175920 TCTAACCTGCCTTTGTCTTAAGG - Intronic
1056261572 9:84854150-84854172 TCCCACCTGTCATTGACTGAAGG - Intronic
1057443139 9:95096381-95096403 TCCATCCTGCCAGGGACTCAGGG - Intergenic
1057793936 9:98142664-98142686 TCCCACCTCCCACAGACTCAGGG + Intronic
1061969328 9:134035484-134035506 TCGTTCCTGCCACTGACTTCAGG + Intronic
1189708715 X:43786469-43786491 CCCAATCTGCCACTGGCTTGAGG + Intronic
1191661388 X:63655304-63655326 TCAAACCTACCACTGACTAATGG + Intronic
1194223386 X:91224692-91224714 TCCAAACTGTCATTTACTTACGG + Intergenic
1200559854 Y:4688075-4688097 TCCAAACTGTCATTTACTTACGG + Intergenic
1200985173 Y:9296041-9296063 TCCAACCTGCCATTAACATATGG - Intergenic
1202125273 Y:21564144-21564166 TCCAACCTGCCATTAACATATGG + Intergenic
1202153735 Y:21865248-21865270 TCCAACCTGCCATTAACATATGG - Intergenic
1202343762 Y:23898525-23898547 TCCATCCTGCTACTGATTTTTGG + Intergenic
1202527006 Y:25771560-25771582 TCCATCCTGCTACTGATTTTTGG - Intergenic