ID: 1075383146

View in Genome Browser
Species Human (GRCh38)
Location 10:122035065-122035087
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075383145_1075383146 -5 Left 1075383145 10:122035047-122035069 CCATAAGTCAGTGGCAGGTTGGA 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1075383146 10:122035065-122035087 TTGGAGACAAGAAGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr