ID: 1075384326

View in Genome Browser
Species Human (GRCh38)
Location 10:122044124-122044146
Sequence CTTCGAAGCCCGAGAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075384326 Original CRISPR CTTCGAAGCCCGAGAGAGCT GGG (reversed) Intronic
903728201 1:25468451-25468473 CTTCGAAGGCCTAGAGTCCTGGG + Intronic
904129303 1:28263661-28263683 CTTGGAAGCCAGACTGAGCTGGG + Intronic
904379123 1:30099614-30099636 CTTCGGAGGCCCAGAGATCTGGG - Intergenic
904813284 1:33178109-33178131 CCTCGAAGCCAGAGGAAGCTGGG - Intronic
912682553 1:111738646-111738668 CTGCCAAGCCCGGCAGAGCTGGG + Intronic
917837797 1:178954473-178954495 CTTCCAAGCCCTAGTGAGCAAGG - Intergenic
920871443 1:209798398-209798420 CTTCATAGCCCGAGTCAGCTGGG - Intronic
923385050 1:233457669-233457691 TTTTGAAGCCAGAGAGATCTGGG - Intergenic
1063415438 10:5869390-5869412 CTGGGCAGCCCCAGAGAGCTGGG - Intronic
1063777975 10:9285861-9285883 CTCCGGAGCCCAAGACAGCTGGG + Intergenic
1067419395 10:46133589-46133611 CTTTGGAGCCGGAGAGAGCCTGG - Intergenic
1067504746 10:46840186-46840208 CTTTGGAGCCGGAGAGAGCCTGG - Intergenic
1068070487 10:52188458-52188480 CTTGGAAGCCTGAGTGAGGTCGG - Intronic
1069689809 10:70342916-70342938 CTTAGAAGCCTGGGAGAGCCTGG - Intronic
1072741408 10:97912256-97912278 CTTTGAAGCCTGAAAGTGCTGGG - Intronic
1074238780 10:111614575-111614597 CTTCAAAGGCAGACAGAGCTGGG - Intergenic
1075384326 10:122044124-122044146 CTTCGAAGCCCGAGAGAGCTGGG - Intronic
1076446433 10:130517468-130517490 CTTGGAGGTTCGAGAGAGCTCGG - Intergenic
1078492195 11:11779878-11779900 CTTCGGAGTCAGAGAGACCTGGG - Intergenic
1079453896 11:20620748-20620770 CTTCAAAGCCAGATAGACCTGGG - Intronic
1084482374 11:69429452-69429474 CTTCCACAACCGAGAGAGCTTGG + Intergenic
1084543631 11:69802595-69802617 CTTTGGAGCCTGAGAGATCTTGG + Intergenic
1093464823 12:19439318-19439340 CTTCGAAGCCCGGCAGGGCGTGG + Intronic
1095990525 12:48031220-48031242 CCTCGCAGCCACAGAGAGCTCGG - Intergenic
1101202627 12:102452758-102452780 CTTCTGAGCCAGAAAGAGCTGGG + Intronic
1102693217 12:114778021-114778043 CTTTAAAGCCAGAGAGAGCTAGG - Intergenic
1111297766 13:86305698-86305720 CTTCGAATCCAGAGAAAGCTAGG + Intergenic
1121307561 14:92916659-92916681 CTTTGGAGCCAGAGAGACCTGGG - Intergenic
1125904536 15:43378878-43378900 CTTTGGAGCCAGATAGAGCTGGG - Intronic
1126574535 15:50183953-50183975 CTTCGAAGTTGGATAGAGCTAGG - Intronic
1128173218 15:65530930-65530952 CTTCGGGTCCCCAGAGAGCTCGG + Intronic
1129389036 15:75211350-75211372 CTTTGGAGCCCGACAGACCTGGG + Exonic
1129712923 15:77830156-77830178 CTTGGAAGCACCAGAGAACTTGG - Intergenic
1130311442 15:82759020-82759042 TTTCCAAGACCTAGAGAGCTTGG - Exonic
1130710781 15:86279000-86279022 CTTTGCAGCCAGAGAGATCTGGG + Intronic
1131057985 15:89387427-89387449 CTAGGAAGCCCCAGAGAGATTGG + Intergenic
1146153380 17:30497393-30497415 CTTTGAAGCCAGAGAGTCCTGGG + Intronic
1157417154 18:47513308-47513330 CTTGGAAGCCCCAGAGAGCATGG - Intergenic
1158201411 18:54945897-54945919 CTTGGAAGCCAGAGAGAGGATGG + Intronic
1160345935 18:78131754-78131776 GTTCAAAGCTCCAGAGAGCTCGG - Intergenic
1167077673 19:47259175-47259197 GTTGGAAGCAAGAGAGAGCTTGG + Intronic
1167750558 19:51377131-51377153 CTTTCAAGCCCGGGAGAGGTTGG - Intergenic
926018505 2:9474731-9474753 CTTCGGCGCCCGAGACGGCTGGG + Intronic
926853341 2:17225397-17225419 CTTCAAAGCCAGAGAAATCTGGG + Intergenic
928182786 2:29081125-29081147 CTTCCAAGCCTGTGGGAGCTTGG + Intergenic
931801754 2:65765528-65765550 CTGAGGAGCCAGAGAGAGCTGGG - Intergenic
939221445 2:139307189-139307211 CTTCAAAGCCCCAGAGTGCATGG + Intergenic
943096865 2:183439709-183439731 TTTTGAAGCCAGAGAGACCTGGG + Intergenic
1172356309 20:34282686-34282708 CTTTGAAGCCAGATAGACCTGGG - Intronic
1173186999 20:40848015-40848037 CTTGGAAGCCAGAGGCAGCTGGG + Intergenic
1182841779 22:33396666-33396688 CGTCCCTGCCCGAGAGAGCTTGG + Intronic
1185413250 22:50697012-50697034 CTGCCAAGCCCGAGGGAGCCTGG + Intergenic
949993770 3:9600801-9600823 CTTCGCCGCCCGAGAGTGCGCGG + Intergenic
950329800 3:12147300-12147322 TTTTGAAGCCAGGGAGAGCTTGG + Intronic
950675342 3:14551045-14551067 CTTCCAGGCCCGGGAGAGCAGGG + Intergenic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
953519200 3:43625038-43625060 CTTGGAAGCCAGAGAGAACATGG - Intronic
958181693 3:90068895-90068917 CTACGAAGTCCAACAGAGCTGGG + Intergenic
960578278 3:119248448-119248470 CTTAGAAGCCAGAGAGGACTGGG + Intergenic
962271631 3:133981724-133981746 CTTCGAAGTCCCAAAGTGCTGGG - Intronic
963051500 3:141147495-141147517 CTTCGGAGCCACAGAGAGCCTGG + Exonic
967038225 3:185664171-185664193 CTTAGAAGCTGGAGGGAGCTAGG + Intronic
977499670 4:97822968-97822990 CTTTGAAGGCCAAGAGAGGTGGG + Intronic
978776450 4:112510762-112510784 CTTGGGAGCCCGAGGGGGCTCGG + Intergenic
986267527 5:6203087-6203109 TCTCGAAGCCCCTGAGAGCTGGG - Intergenic
989266970 5:39486304-39486326 CTTTGAAGGCAGAGGGAGCTAGG - Intergenic
993532428 5:89041058-89041080 CTAAGAAGCCAGAGAGAGCTGGG + Intergenic
999654082 5:153795673-153795695 CTTGGAGGCCTTAGAGAGCTGGG + Intronic
1026829181 7:73600779-73600801 CTGGGAAGCCTGCGAGAGCTGGG + Intronic
1027244789 7:76359422-76359444 CTTCGAATCCCGAGGCCGCTGGG + Intergenic
1029607243 7:101606386-101606408 CTTTGTAGCCCCAGGGAGCTGGG - Intergenic
1030524515 7:110637318-110637340 CTTAGAAGCCCGTGGGAACTGGG - Intergenic
1034990278 7:155543578-155543600 CTTTGAAGCATGAGAGTGCTGGG + Intergenic
1037594937 8:20347014-20347036 CTGCAAAGCCCGAGTGGGCTGGG - Intergenic
1037925520 8:22841210-22841232 CTTCGCAGTCAGACAGAGCTGGG - Intronic
1038985116 8:32800758-32800780 CTTGGAAGCAGGATAGAGCTGGG - Intergenic
1047742203 8:127815602-127815624 CTGCCATGCCCAAGAGAGCTGGG - Intergenic
1048417103 8:134239623-134239645 TTTGGAAGCCAGAGAGACCTGGG - Intergenic
1053561350 9:39198502-39198524 CTGCGAAGCTGGAGAGACCTGGG + Intronic
1053825447 9:42018740-42018762 CTGCGAAGCTGGAGAGACCTGGG + Intronic
1054135769 9:61420445-61420467 CTGCGAAGCTGGAGAGACCTGGG - Intergenic
1054605116 9:67168617-67168639 CTGCGAAGCTGGAGAGACCTGGG - Intergenic
1057533489 9:95875746-95875768 CGGCGGAGCCCGAGAGAACTAGG + Exonic
1059170010 9:112115989-112116011 CTTCAAAGCCCCAGAGCTCTTGG + Intronic
1060881206 9:127119461-127119483 CTTTGGAGCCAGACAGAGCTGGG + Intronic
1062262728 9:135670925-135670947 TTTCGATGCCCGAGAGACCCTGG - Intergenic
1186763985 X:12752141-12752163 CTTGGGAGCCAGAGAGACCTGGG + Intergenic
1186805777 X:13139190-13139212 CTTCCAAGCCTGTGAGAGCAGGG - Intergenic
1191870102 X:65738492-65738514 ATTGGAAGCCTGTGAGAGCTGGG - Intronic
1195509107 X:105693819-105693841 CTTTGAAGCTCGAGGAAGCTGGG + Intronic
1197456334 X:126680435-126680457 CTATGAAGGCCGAGAGAGGTGGG - Intergenic
1198795038 X:140385528-140385550 CCTCGAAGCCGAAAAGAGCTTGG - Intergenic
1200080969 X:153576187-153576209 CTTGGCAGCCAGAGAGAGCTCGG + Intronic
1201386331 Y:13443339-13443361 CCTCGAAGCTGGACAGAGCTGGG - Intronic