ID: 1075388505

View in Genome Browser
Species Human (GRCh38)
Location 10:122075308-122075330
Sequence GCACCTGCACTGATGCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 191}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075388505_1075388513 5 Left 1075388505 10:122075308-122075330 CCAAGCTGCATCAGTGCAGGTGC 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1075388513 10:122075336-122075358 AGGATGGGGAAGGCTGGCCCAGG No data
1075388505_1075388515 20 Left 1075388505 10:122075308-122075330 CCAAGCTGCATCAGTGCAGGTGC 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1075388515 10:122075351-122075373 GGCCCAGGGAGCTCGTCACGTGG No data
1075388505_1075388512 -1 Left 1075388505 10:122075308-122075330 CCAAGCTGCATCAGTGCAGGTGC 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1075388512 10:122075330-122075352 CCATGAAGGATGGGGAAGGCTGG No data
1075388505_1075388510 -5 Left 1075388505 10:122075308-122075330 CCAAGCTGCATCAGTGCAGGTGC 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1075388510 10:122075326-122075348 GGTGCCATGAAGGATGGGGAAGG No data
1075388505_1075388508 -10 Left 1075388505 10:122075308-122075330 CCAAGCTGCATCAGTGCAGGTGC 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1075388508 10:122075321-122075343 GTGCAGGTGCCATGAAGGATGGG No data
1075388505_1075388509 -9 Left 1075388505 10:122075308-122075330 CCAAGCTGCATCAGTGCAGGTGC 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1075388509 10:122075322-122075344 TGCAGGTGCCATGAAGGATGGGG No data
1075388505_1075388514 6 Left 1075388505 10:122075308-122075330 CCAAGCTGCATCAGTGCAGGTGC 0: 1
1: 0
2: 0
3: 21
4: 191
Right 1075388514 10:122075337-122075359 GGATGGGGAAGGCTGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075388505 Original CRISPR GCACCTGCACTGATGCAGCT TGG (reversed) Intronic
900002195 1:20897-20919 CCTCCTGCTCTGCTGCAGCTGGG - Intergenic
900147207 1:1163462-1163484 GCCCCTGCGCAGATGCGGCTGGG + Intergenic
900782285 1:4626069-4626091 ACACCTGTGCTGAGGCAGCTGGG + Intergenic
902090432 1:13898613-13898635 GCACCTGGACTGCTGCTGCTTGG + Intergenic
903608052 1:24589403-24589425 CCACCTTCTCTGATGCAGCAGGG + Intronic
904037898 1:27568627-27568649 GCACCTGGAGTGATGTCGCTAGG + Intronic
904265790 1:29317961-29317983 GGACCTTCCCTGATGCTGCTGGG - Intronic
904366515 1:30014303-30014325 GCACCTGCTCTGATGGAGCCAGG - Intergenic
904412929 1:30335868-30335890 GCACCAGCTCTGATGCCACTGGG + Intergenic
906152210 1:43594127-43594149 GCACCTGCTGTGCTGCAGCTGGG - Intronic
907300533 1:53483936-53483958 GCCCCTGCTCTGCTGCACCTGGG - Intergenic
909747380 1:79114100-79114122 GCAGCTGCACTGAAGGAGCAAGG + Intergenic
910147441 1:84098714-84098736 GTGCCTGCACTTGTGCAGCTGGG - Intronic
910647742 1:89531676-89531698 GTATCTGCACTGATGCAGCCAGG - Intronic
911553178 1:99308944-99308966 GCACCTGAAATGCTGCAGCAGGG - Exonic
913695950 1:121325835-121325857 GCACCTTCACGGATGCAATTAGG - Intronic
913955526 1:143287806-143287828 GAATCTGCCCTGATGCAGCCAGG + Intergenic
913981906 1:143527635-143527657 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914076269 1:144354290-144354312 GAATCTGCCCTGATGCAGCCAGG - Intergenic
914102909 1:144612206-144612228 GAATCTGCCCTGATGCAGCCAGG + Intergenic
914141614 1:144954224-144954246 GCACCTTCACGGATGCAATTAGG + Intronic
914408516 1:147402100-147402122 GAATCTGCATTGATGCAGCCAGG - Intergenic
914964001 1:152236768-152236790 TCACCTTCACCAATGCAGCTGGG + Intergenic
918087414 1:181257499-181257521 TCACCTGCTGTGATGCTGCTAGG + Intergenic
918725177 1:187912360-187912382 GCATCTGAACTAACGCAGCTTGG + Intergenic
918960533 1:191270847-191270869 ACACCTGCACTGAAGAATCTAGG + Intergenic
920483276 1:206344203-206344225 GCACCTTCACGGATGCAATTAGG - Intronic
1063328310 10:5127679-5127701 GCACCTGCACTCCAGCAGCCTGG + Intronic
1064943422 10:20760395-20760417 GCACATCCACAGATTCAGCTGGG - Intergenic
1067208870 10:44242187-44242209 GCACCTGCCCTGGTACAGGTGGG + Intergenic
1068811816 10:61264336-61264358 GCACCTGCAATGTTGAAGGTGGG + Intergenic
1069060243 10:63887327-63887349 GCAGCCGCACTGCTGCGGCTGGG + Intergenic
1069189921 10:65474332-65474354 GCAATTGCACTGATGCAGTCTGG + Intergenic
1073062369 10:100740310-100740332 GCAGCTGCGCTGGTGCAGTTGGG + Intronic
1075388505 10:122075308-122075330 GCACCTGCACTGATGCAGCTTGG - Intronic
1076164310 10:128269446-128269468 GCACCTGCCCAGCTGCATCTTGG - Intergenic
1076992743 11:284291-284313 GCCCCCGCACTGACGGAGCTGGG + Exonic
1081138804 11:39472647-39472669 TCATCTTCACTGATGCATCTTGG - Intergenic
1081725816 11:45328337-45328359 GTCCCTGGACTGATGGAGCTGGG - Intergenic
1086496474 11:87409531-87409553 GCACCAACACTTCTGCAGCTTGG + Intergenic
1087011004 11:93513979-93514001 GTCCCTGCCCTGAAGCAGCTTGG - Intronic
1089840292 11:121411368-121411390 GAATCTGCATTGATGCAGCCAGG - Intergenic
1091317606 11:134625471-134625493 GCATCTGCGTTGATGCAGCCAGG - Intergenic
1091801710 12:3328676-3328698 GCACCTGCTCTGACTCTGCTGGG + Intergenic
1093483337 12:19627510-19627532 GCAGCTGCACTGAAGCAGAACGG - Intronic
1096570938 12:52522787-52522809 GCACCAGCACCACTGCAGCTCGG + Intergenic
1096833124 12:54330048-54330070 GCACCAGCAAGGACGCAGCTGGG - Intronic
1096999026 12:55860177-55860199 GAATCTGCATTGATACAGCTTGG - Intergenic
1097256066 12:57675327-57675349 GCACCTGGACTGCTGCCCCTGGG - Intergenic
1097599052 12:61669576-61669598 GAATCTGCATTGATGCAGCCAGG - Intergenic
1098845583 12:75531220-75531242 GCAGCAACACAGATGCAGCTGGG + Intergenic
1102305335 12:111800299-111800321 TCTCCTGCCCTGAGGCAGCTGGG - Intronic
1102320369 12:111928314-111928336 TCACCTCCACTGAGGCAGCAGGG - Intergenic
1104317831 12:127720671-127720693 GCAGCTCCACTGTTTCAGCTTGG + Intergenic
1104953016 12:132450952-132450974 ACACCTGCGCTGATGCTGCCTGG - Intergenic
1106575246 13:30968405-30968427 GAATCTGCACTGATGAAGCCTGG - Intronic
1109561004 13:64050056-64050078 AAATCTGCATTGATGCAGCTAGG - Intergenic
1112333419 13:98494829-98494851 GCACCCGCACTGAGGCACCCCGG + Intronic
1113527458 13:110992029-110992051 GCACCTGCACTCCTGCCCCTGGG - Intergenic
1118616600 14:67578323-67578345 TCAGCCGTACTGATGCAGCTTGG - Intronic
1119289454 14:73483378-73483400 GCTCCTGCACTCTGGCAGCTGGG - Intronic
1122194542 14:100075149-100075171 GCCCCTGCAGCCATGCAGCTTGG - Intronic
1123468278 15:20531755-20531777 GCAGCTGCACGGGAGCAGCTGGG - Intergenic
1123649838 15:22469309-22469331 GCAGCTGCACGGGAGCAGCTGGG + Intergenic
1123681286 15:22765976-22765998 GCAGCTGCACGGGAGCAGCTGGG - Intergenic
1123728595 15:23126965-23126987 GCAGCTGCACGGGAGCAGCTGGG - Intergenic
1123740239 15:23278128-23278150 GCAGCTGCACGGGAGCAGCTGGG + Intergenic
1123746759 15:23324430-23324452 GCAGCTGCACGGGAGCAGCTGGG - Intergenic
1124279026 15:28347746-28347768 GCAGCTGCACGGGAGCAGCTGGG - Intergenic
1124303672 15:28563862-28563884 GCAGCTGCACGGGAGCAGCTGGG + Intergenic
1124633318 15:31349584-31349606 GCCCTTGCACTCATGCAGCCAGG - Intronic
1125603572 15:40928160-40928182 GCAGCTGCGCTGCTGCCGCTTGG + Intergenic
1127725329 15:61744049-61744071 GCACATGCAATGATTCAGATAGG + Intergenic
1128449039 15:67791073-67791095 GCTCCTGCCCAGCTGCAGCTCGG - Intronic
1129825791 15:78634312-78634334 GCAGCTGCACCGCAGCAGCTGGG + Intronic
1130026011 15:80271076-80271098 GCAGCTGGAGAGATGCAGCTAGG - Intergenic
1132451315 15:101970042-101970064 CCTCCTGCTCTGCTGCAGCTGGG + Intergenic
1132627344 16:897775-897797 GCACCACCCCTGCTGCAGCTGGG - Intronic
1136293624 16:29290031-29290053 CCACATGCACTCATGGAGCTCGG + Intergenic
1138008953 16:53360461-53360483 GCAGCTGCACGGGAGCAGCTGGG - Intergenic
1139950535 16:70666201-70666223 GCAGCTGTGCTGATGCTGCTGGG + Intronic
1140264142 16:73405993-73406015 GCATCTACGCTGATGCTGCTTGG - Intergenic
1140609828 16:76584562-76584584 GCAGCTGCATGGATGCAGCTGGG - Intronic
1142486484 17:250831-250853 GGTCCTGCAGTGATGGAGCTTGG - Intronic
1144762411 17:17714831-17714853 GCACCTGCAACGAGGCAGCTTGG - Intronic
1146053048 17:29567610-29567632 GGACCCGCACTGATGCAGGCGGG - Intronic
1148539475 17:48468462-48468484 GCACCTGCACTCAGGCAGGCCGG - Intergenic
1149481662 17:57008456-57008478 TCACCTGCACAGATGAAGCTAGG + Intergenic
1152419985 17:80187550-80187572 GCTCCTGCAATGGTCCAGCTGGG - Intronic
1152665332 17:81565382-81565404 GCACCTGCCAGGATGCAGCTGGG + Intronic
1153350913 18:4080526-4080548 GAATCTGCATTGATGCAGCCAGG + Intronic
1154323036 18:13369678-13369700 GCCCCTGCACTGCAGCACCTTGG + Intronic
1157815780 18:50728683-50728705 CCAGCTGCTCTGATGCTGCTGGG - Intronic
1158422632 18:57309506-57309528 GCACCTGGAAGGATGCAACTGGG + Intergenic
1159206117 18:65255214-65255236 GAATCTGCACTAATGCAGCCTGG + Intergenic
1159625687 18:70691460-70691482 ACACCTGCAATGATGGAGCCTGG - Intergenic
1160633948 19:62505-62527 CCTCCTGCTCTGCTGCAGCTGGG - Intergenic
1161089116 19:2351466-2351488 GCACTGGCCCTGATGCAGCGTGG + Exonic
1161251135 19:3280985-3281007 GCACCTGTGCAGATGCTGCTGGG + Intronic
1161847652 19:6720831-6720853 GCAGCTGCATTCATGCTGCTGGG - Intronic
1162773543 19:12965176-12965198 GCGACTGCACTGATCCAGGTAGG + Intronic
1164612994 19:29645796-29645818 ACATCTGCACTAATGCAGCCAGG - Intergenic
925240446 2:2321221-2321243 CCACCTGCCCTAATGCATCTGGG - Intronic
925426858 2:3756590-3756612 GCACTTGCACTAATGCAGCGTGG + Intronic
927711344 2:25328335-25328357 GGGCCTGGAATGATGCAGCTGGG - Intronic
927817953 2:26236864-26236886 GCACCTGCAATAAAGCAGCCTGG + Exonic
931936392 2:67201678-67201700 GCACCTGAACTAATGAAGCCTGG - Intergenic
932381251 2:71285353-71285375 GAACCTTCACTGTAGCAGCTTGG + Intronic
935815713 2:106844071-106844093 GCATCTGCTCAGATGCTGCTGGG + Intronic
936567530 2:113592523-113592545 CCTCCTGCTCTGCTGCAGCTGGG + Intergenic
936992676 2:118382938-118382960 GGACCTGCACTGTGGCAGCTAGG + Intergenic
938120715 2:128631327-128631349 CCACCTGCAGTGATGCTGCTGGG - Intergenic
941391807 2:164924162-164924184 GCAGCTACATGGATGCAGCTTGG + Intronic
942051888 2:172147739-172147761 GAATCTGCATTGATGCAGCCAGG - Intergenic
942450443 2:176105525-176105547 GCACCGGCACTGCAGCAGCCCGG + Intronic
944731384 2:202521070-202521092 GCACCTGGACTGCTGCCCCTGGG - Intronic
947008046 2:225535157-225535179 CCACCTGCACTGCAGAAGCTTGG + Intronic
948335150 2:237201707-237201729 GCACCACCAGTGAGGCAGCTGGG + Intergenic
948797370 2:240411907-240411929 GCACCTGCCATGGGGCAGCTTGG + Intergenic
948879105 2:240847061-240847083 AAACCTGCATTGATGCAGCCAGG - Intergenic
949022430 2:241749079-241749101 GCTCCTGCTCTCCTGCAGCTGGG + Intronic
1169193327 20:3671034-3671056 CCATCTGCAGCGATGCAGCTGGG - Exonic
1172210030 20:33190896-33190918 GCACCTGCCCTGGGGCAGATGGG - Intergenic
1174269959 20:49360693-49360715 GCTCCTCCACTGCTGCAGCTTGG - Intergenic
1175857997 20:62133124-62133146 GCACCTGCAGTGCCGGAGCTGGG + Intronic
1176215235 20:63944800-63944822 GCCCCTGCACTGAGGCCGCCTGG + Intronic
1183061301 22:35337916-35337938 GCACCCCCACTGCGGCAGCTGGG + Intronic
1184065462 22:42116852-42116874 GCACCTGCCCTGGTGGAGGTGGG + Intergenic
1184259418 22:43306064-43306086 GCATCTGCCCCGATGCAGCCAGG + Intronic
950078460 3:10204419-10204441 GTACCTGCAATGACACAGCTCGG + Intronic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
954481865 3:50806863-50806885 GCAACTGCACTGCTCCAGGTTGG - Intronic
956702398 3:71969981-71970003 AAACCAGCACTGCTGCAGCTGGG - Intergenic
958717584 3:97804189-97804211 AAATCTGCACTGATGCAGCCAGG + Intergenic
958726928 3:97917323-97917345 GCACCTTCACTTATGCTGCCTGG - Intronic
962172182 3:133113232-133113254 GCACCTGCTTTGGTTCAGCTGGG + Intronic
967149865 3:186638612-186638634 GCACCACCACTTATGCACCTGGG - Intronic
967248177 3:187509768-187509790 CAATCTGCACTGATGCAGCTGGG - Intergenic
968596244 4:1487324-1487346 GCCCCTGCAGGGAAGCAGCTGGG - Intergenic
968620348 4:1601091-1601113 CCACCTCCACTGTGGCAGCTGGG - Intergenic
973284619 4:48402011-48402033 TCTCCTTCACTTATGCAGCTTGG + Intronic
978710043 4:111769235-111769257 TCTCCTGCACTTATGAAGCTTGG + Intergenic
978840775 4:113209368-113209390 GAATCTGCATTGATGCAGCCAGG - Intronic
983845531 4:172513792-172513814 GCACCTGCTCTGTTGGAGGTAGG + Intronic
984020087 4:174474985-174475007 GCACCAGCTCTGATGGAGGTAGG - Intergenic
984141262 4:176006057-176006079 AAACCTGCATTGATGCAGCCAGG - Intergenic
985703331 5:1386635-1386657 GCACCTGCACTTGCGCAGCAAGG - Intergenic
985816415 5:2131347-2131369 GCACCTGCGGTGAGGCAGCCTGG + Intergenic
986091464 5:4512393-4512415 ACACCTGAACTGATACAACTGGG - Intergenic
986416139 5:7530034-7530056 GCTCATGCAGTGTTGCAGCTTGG - Intronic
986509457 5:8488690-8488712 GAATCTGCAGTGATGCAGCCAGG - Intergenic
987103157 5:14610503-14610525 GCAGCTGCACTGATACATTTGGG + Exonic
993415955 5:87631273-87631295 ACAACTGCAATGACGCAGCTTGG + Intergenic
993578751 5:89634164-89634186 TCTCCTTCACTGATGAAGCTTGG + Intergenic
995145916 5:108787077-108787099 GCAGCTGCCCAGCTGCAGCTTGG + Intronic
995262084 5:110116045-110116067 GTACTTCCACTGATACAGCTGGG - Intergenic
995516601 5:112960433-112960455 GCCCCTGCACAGATGGATCTAGG - Intergenic
998672910 5:144373953-144373975 GAAACTGCAGTGATGCAGCTAGG - Intronic
999737285 5:154522118-154522140 GCACCCCCACTAATGCAGCACGG + Intergenic
1002874985 6:1202648-1202670 GAACCTGCACTTCTGTAGCTGGG - Intergenic
1005308209 6:24533979-24534001 GTGCCTGCTCTGAGGCAGCTGGG - Exonic
1006573608 6:35026362-35026384 GCACCTGCTCTGTTCCAGGTAGG + Intronic
1006975016 6:38091870-38091892 GGACTTGCGCTGATGCAGCGAGG + Intronic
1007663245 6:43499238-43499260 CCACCTGCACTACTGCGGCTAGG - Intronic
1007976140 6:46103403-46103425 CAATCTGCACTGATGCAGCTAGG + Intergenic
1016217822 6:141624601-141624623 GAACTTGCAGTGATGCAGCAAGG - Intergenic
1023686084 7:42737033-42737055 GCACCTGCACTGCTGTAACCTGG - Intergenic
1029214275 7:98934582-98934604 GCACGTGTTCTGATGCAGCCAGG - Intronic
1030116109 7:106063477-106063499 GAATCTGCATTGATGCAGCCAGG - Intergenic
1033012426 7:137636637-137636659 TCACTTGAGCTGATGCAGCTTGG + Intronic
1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG + Intergenic
1045862696 8:106831079-106831101 GCGCATGCTCTGATGGAGCTAGG - Intergenic
1045886570 8:107105687-107105709 GCAGCTGCAGTGCTGTAGCTTGG - Intergenic
1047330756 8:123884732-123884754 GACCCTGCAGTGAGGCAGCTTGG + Intronic
1048941539 8:139404552-139404574 GCACCTGCTCTGTTGCTCCTGGG - Intergenic
1049175581 8:141190575-141190597 CCACCTGCACTGCTGCTCCTGGG + Intronic
1049690960 8:143958690-143958712 GCACCTGCTCTGCTGCAGCAGGG + Intronic
1049807079 8:144545984-144546006 GCCCGTCCACAGATGCAGCTGGG + Intronic
1049885003 9:21010-21032 CCTCCTGCTCTGCTGCAGCTGGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055754099 9:79539087-79539109 GCCCCTGCACTGCCGGAGCTGGG + Intergenic
1056348464 9:85723419-85723441 CAACCTGCAATGCTGCAGCTTGG - Intronic
1056548170 9:87630053-87630075 GCAGGGGCACTGAAGCAGCTCGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057016764 9:91658884-91658906 GCATCTGCACTCATGAAGCTGGG - Intronic
1057032168 9:91784157-91784179 GAATCAGCACTGTTGCAGCTGGG - Intronic
1057181809 9:93034660-93034682 GCACCTGCAGGGAGGCAGCCAGG + Exonic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1061971208 9:134046419-134046441 GCACCTGGACAAATGCAGCCTGG - Intronic
1062105322 9:134752066-134752088 GGCCCTGCACTGGTGCAGGTGGG + Intronic
1062271807 9:135713280-135713302 GCAGCTACGCTGATGCAGTTAGG + Intronic
1186542173 X:10411838-10411860 GCACCTGAACTGATGTTGCTGGG - Intergenic
1186830295 X:13383469-13383491 AAATCTGCACTGATGCAGCCAGG - Intergenic
1187526224 X:20057572-20057594 GCACCTTCACTGCAGCAGCAAGG - Intronic
1188060727 X:25598068-25598090 GCAACTCCACTGGTGCAGCCAGG - Intergenic
1188361162 X:29255753-29255775 GCAGCAACACGGATGCAGCTGGG - Intronic
1189093141 X:38108944-38108966 GCATCAGCACCGATGCAGTTTGG - Intronic
1189683815 X:43543262-43543284 AAATCTGCATTGATGCAGCTAGG + Intergenic
1190742589 X:53299682-53299704 CCATCTGCAGGGATGCAGCTGGG + Intronic
1191844650 X:65537868-65537890 GTACCTGCACTCAGGTAGCTTGG + Intergenic
1192160414 X:68782218-68782240 GAATCTGCACTGATGCAGCCAGG - Intergenic
1192161433 X:68791131-68791153 GAATCTGCACTGATGCAGCCAGG + Intergenic
1192231493 X:69268170-69268192 GAATCTGCATTGATGCAGCCAGG - Intergenic
1192239305 X:69316742-69316764 GAATCTGCATTGATGCAGCCAGG + Intergenic
1192790974 X:74381584-74381606 GAATCTGCATTGATGCAGCCAGG + Intergenic
1194335757 X:92644255-92644277 GCACCCTCTCTGATGCAGGTTGG + Intergenic
1194470192 X:94284963-94284985 GCACCTGCTCTGGTGGAGGTAGG + Intergenic
1194478404 X:94389259-94389281 GCATCTGCATTGATGTAGCCAGG - Intergenic
1196796123 X:119503284-119503306 GCAACTGCTCTGATGCAGTTGGG - Intergenic
1198414745 X:136408512-136408534 GCAGCAGCATGGATGCAGCTAGG - Intronic
1200644183 Y:5761006-5761028 GCACCCTCTCTGATGCAGGTTGG + Intergenic