ID: 1075389561

View in Genome Browser
Species Human (GRCh38)
Location 10:122082937-122082959
Sequence TGCCGCCGCGATGTCTCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075389561_1075389564 -8 Left 1075389561 10:122082937-122082959 CCCCAGGAGACATCGCGGCGGCA 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1075389564 10:122082952-122082974 CGGCGGCATTTCCCGCTGAGAGG 0: 1
1: 0
2: 0
3: 1
4: 30
1075389561_1075389565 -7 Left 1075389561 10:122082937-122082959 CCCCAGGAGACATCGCGGCGGCA 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1075389565 10:122082953-122082975 GGCGGCATTTCCCGCTGAGAGGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075389561 Original CRISPR TGCCGCCGCGATGTCTCCTG GGG (reversed) Exonic
901010602 1:6199561-6199583 CGCTGCCGCCATGGCTCCTGTGG - Exonic
901802148 1:11714493-11714515 TGCCGCTCCGATCTCTCTTGGGG - Intronic
904810897 1:33162831-33162853 TGCAGCTGGGATGTCTCCTGGGG - Intronic
905546516 1:38804412-38804434 TTCGGCCGCGGTGGCTCCTGCGG - Intergenic
916091328 1:161309893-161309915 TGCCCCAGCTATGGCTCCTGGGG - Exonic
917325167 1:173824591-173824613 TGCCGCCGCCATGCCTACTACGG - Exonic
920338931 1:205263248-205263270 TGCCACCGTGATGTCTTCAGAGG + Intronic
922762621 1:228142124-228142146 TGCCTCCGCCCTGTCTCCAGCGG + Intronic
1075389561 10:122082937-122082959 TGCCGCCGCGATGTCTCCTGGGG - Exonic
1084409260 11:68997003-68997025 TGCCGCCAAGCTGTCTCCTGTGG - Intergenic
1088551681 11:111019718-111019740 CTCCACCGAGATGTCTCCTGTGG + Intergenic
1091699988 12:2652892-2652914 TGCCCCCCCGACATCTCCTGGGG + Intronic
1095978212 12:47954253-47954275 TGCCTCCCAGATGGCTCCTGCGG + Intergenic
1096771479 12:53938629-53938651 TGCCCCGGCCAGGTCTCCTGGGG - Intergenic
1098416881 12:70243870-70243892 TGCCGCCGCGCTGCTTCCTGGGG + Intronic
1100841201 12:98613160-98613182 TGCCGCAGCCCTGTCCCCTGAGG + Intergenic
1103829776 12:123769514-123769536 TGCCACAGCAATGTCTGCTGAGG + Intronic
1114254495 14:20989992-20990014 TGCCGCCGCCATGGCTCCGGAGG - Exonic
1123031553 14:105454160-105454182 TGACGCCTCTCTGTCTCCTGTGG + Intronic
1132481527 16:168675-168697 TGCCGTGGTGCTGTCTCCTGAGG + Intergenic
1136229876 16:28879886-28879908 TCCCGCCGCGATGCCGGCTGCGG + Intronic
1141118224 16:81329984-81330006 TGCCTCCTAGATTTCTCCTGGGG - Intronic
1141660838 16:85440712-85440734 TGCCCCCGTGATGGTTCCTGGGG - Intergenic
1141766518 16:86063197-86063219 TGCCTCTGCCATGTCTCGTGTGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1148835048 17:50461544-50461566 TGCTGCCTCTATGCCTCCTGGGG + Intronic
1149608412 17:57941189-57941211 TGCAGCCGAAATGTCTCCTCTGG + Intronic
1151720681 17:75854259-75854281 TGACTCCACGATGTCTCCTTTGG + Intronic
1160540895 18:79621854-79621876 TGCCGCCGTGACGTCTCCGTTGG - Intergenic
1160965483 19:1745381-1745403 TGCCGGCGCTATGACCCCTGGGG + Intergenic
1161175935 19:2842011-2842033 CGACGCCGCGGTGCCTCCTGGGG + Intronic
1165900994 19:39169288-39169310 TCCTGCCGCTCTGTCTCCTGCGG - Intronic
930003183 2:46875006-46875028 TGCGGCCGGGATGCCTTCTGGGG + Intergenic
1180190086 21:46158793-46158815 TGGCGTGGCCATGTCTCCTGGGG - Intergenic
1181531936 22:23521926-23521948 TGGCGCCGCGCTGTCTGCCGCGG - Intergenic
1181817299 22:25448148-25448170 AGCCGCCGCGGTGCCCCCTGAGG - Intergenic
962299119 3:134221956-134221978 TGCAGCCCCCATGTGTCCTGTGG - Intronic
982746054 4:159104226-159104248 GGCCGCCGCGTTCTCACCTGGGG - Intronic
999271891 5:150301581-150301603 GGCAGCCTCTATGTCTCCTGAGG - Intronic
1002785141 6:394171-394193 TGCCATCCAGATGTCTCCTGTGG + Intronic
1008109586 6:47477987-47478009 TCCCGCCGCCGTGGCTCCTGGGG + Exonic
1014799288 6:125759591-125759613 TGCAGCCGCGGTGGCTGCTGCGG - Exonic
1015519661 6:134117650-134117672 TGCCACAGGGACGTCTCCTGGGG + Intergenic
1018892355 6:167990847-167990869 TGCCTCCCCGACGGCTCCTGTGG + Intergenic
1026732642 7:72925112-72925134 CGGAGCCGCGATGTCTCCGGCGG + Intronic
1027111422 7:75442707-75442729 CGGAGCCGCGATGTCTCCGGCGG - Intronic
1027283651 7:76627240-76627262 CGGAGCCGCGATGTCTCCGGCGG - Exonic
1036566799 8:9944918-9944940 AGCCTCCGTGATGTCTGCTGTGG + Intergenic
1040593831 8:48819302-48819324 TGCCGCTGGGATGTCTGCAGGGG + Intergenic
1195716807 X:107826190-107826212 GGCCGCCGTGCTGTCCCCTGCGG + Exonic