ID: 1075394264

View in Genome Browser
Species Human (GRCh38)
Location 10:122115238-122115260
Sequence CACAGCCCCCACCTTCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075394256_1075394264 28 Left 1075394256 10:122115187-122115209 CCACAAGAGTAACACAGAGCCTG 0: 1
1: 0
2: 1
3: 28
4: 215
Right 1075394264 10:122115238-122115260 CACAGCCCCCACCTTCAAGGAGG No data
1075394262_1075394264 9 Left 1075394262 10:122115206-122115228 CCTGGGAGGTAGATGGTGGTTGA 0: 1
1: 0
2: 1
3: 24
4: 276
Right 1075394264 10:122115238-122115260 CACAGCCCCCACCTTCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075394264 Original CRISPR CACAGCCCCCACCTTCAAGG AGG Intronic
No off target data available for this crispr