ID: 1075394353

View in Genome Browser
Species Human (GRCh38)
Location 10:122115843-122115865
Sequence TCATCTGTGCAAAAGTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075394353_1075394358 1 Left 1075394353 10:122115843-122115865 CCTTGCAACTTTTGCACAGATGA 0: 1
1: 1
2: 1
3: 15
4: 172
Right 1075394358 10:122115867-122115889 CAGGAGGTGGTTTAGGAAGCTGG No data
1075394353_1075394357 -6 Left 1075394353 10:122115843-122115865 CCTTGCAACTTTTGCACAGATGA 0: 1
1: 1
2: 1
3: 15
4: 172
Right 1075394357 10:122115860-122115882 AGATGATCAGGAGGTGGTTTAGG No data
1075394353_1075394359 26 Left 1075394353 10:122115843-122115865 CCTTGCAACTTTTGCACAGATGA 0: 1
1: 1
2: 1
3: 15
4: 172
Right 1075394359 10:122115892-122115914 ATAAAATCAGTAACTAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075394353 Original CRISPR TCATCTGTGCAAAAGTTGCA AGG (reversed) Intronic
904898682 1:33838366-33838388 CCATCTTTTAAAAAGTTGCAGGG + Intronic
904918529 1:33987608-33987630 TCCTCTGTGGATAAATTGCAAGG + Intronic
906160930 1:43648838-43648860 TCATCTTTACAAAATTTGCAAGG + Intergenic
906429293 1:45741965-45741987 TCACTTGTCCACAAGTTGCATGG + Intronic
908609574 1:65842325-65842347 TCATATATGAAAGAGTTGCATGG + Intronic
915060588 1:153180177-153180199 TCATTTGTGCATTGGTTGCATGG - Intergenic
919583234 1:199403868-199403890 TCATCTGCCAATAAGTTGCATGG + Intergenic
919835890 1:201573023-201573045 TCATCACTGGAAAGGTTGCATGG + Intergenic
921401754 1:214731541-214731563 AAATCTCTGCAAAATTTGCAGGG - Intergenic
921605522 1:217149310-217149332 TCATCTTTGAAAAAGGAGCAAGG + Intergenic
923775349 1:236973457-236973479 TGATTTGTGCAAAAGTTGTAAGG - Intergenic
1063892249 10:10642611-10642633 TTATCTCTGCAAATGTTACAGGG + Intergenic
1064168405 10:13006430-13006452 TGGGCTGTGCAAAAGTTGCATGG - Intronic
1064510137 10:16081159-16081181 TCATTTGTGCACTTGTTGCATGG + Intergenic
1065232682 10:23614604-23614626 TCATTTGAGCAAACTTTGCAAGG + Intergenic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1070589470 10:77791571-77791593 TCATCAGTGCAATGTTTGCAGGG - Exonic
1072070527 10:91911075-91911097 TCATCAGTTCAAATGTTTCATGG + Intergenic
1073580228 10:104658983-104659005 TCATCTGTTTAATAGTTGCAAGG + Intronic
1074312957 10:112338220-112338242 TCATCCATGCCAAAGTAGCAAGG + Intergenic
1075069620 10:119312314-119312336 AGAGCTGTGCAAAAGCTGCAAGG + Intronic
1075394353 10:122115843-122115865 TCATCTGTGCAAAAGTTGCAAGG - Intronic
1079540097 11:21562919-21562941 TCATCTGTGGACATGTTTCAAGG - Intronic
1079574402 11:21985499-21985521 TTATCTGTGTAACAGTAGCATGG - Intergenic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1084524191 11:69685803-69685825 GCTTGTCTGCAAAAGTTGCAGGG + Intergenic
1085351643 11:75801626-75801648 TCATGTGGGCCAAAGGTGCAAGG - Intergenic
1086108346 11:83171331-83171353 ATATCTGTGGAAAAGTGGCAAGG + Intronic
1086566837 11:88236681-88236703 GCATCTATGCAAAGGCTGCAAGG - Intergenic
1091027386 11:132154022-132154044 TCATGTGTGCAAAGCTTGGAAGG + Intronic
1091990973 12:4955631-4955653 GCAGCTCTGCAAAAGTAGCAGGG - Intergenic
1092296441 12:7202815-7202837 TCATCTGTGTCAGAGTTGCTTGG + Intronic
1095274803 12:40268107-40268129 TCATCTGTGGAAAAGCTAAAAGG - Intronic
1098309562 12:69134791-69134813 TCATCTGTTAAACACTTGCAAGG - Intergenic
1098926248 12:76352161-76352183 TCATCAGTTCAAATGTTTCATGG + Exonic
1099564512 12:84225693-84225715 TTATCTGTGCTACAGTTTCAAGG + Intergenic
1102507591 12:113393414-113393436 TCATCTGAGCAAGAGTTCCATGG + Intronic
1105925641 13:25005175-25005197 TCATGGGTGGAAAAGCTGCAAGG - Intergenic
1106039061 13:26072485-26072507 TCATGGGTGGAAAAGCTGCAAGG + Intergenic
1106232489 13:27831649-27831671 TTACCTGTGCAAAAGATGTACGG - Intergenic
1106316283 13:28596776-28596798 TCTTCTGTCTAAAAGTTGTACGG - Intergenic
1108096603 13:46908360-46908382 CCATCTGTGTGATAGTTGCATGG - Intergenic
1108424989 13:50290636-50290658 TCATCTGAGGCAAAGTTTCATGG + Intronic
1108460109 13:50657278-50657300 TCATATGTGCAAATGTGGAAAGG + Intronic
1109908834 13:68884096-68884118 TCATCAGTACAATAGTTGAAAGG - Intergenic
1110147103 13:72205075-72205097 ACATCTGTGCAAATCTAGCAAGG + Intergenic
1114387751 14:22272613-22272635 GCATCTGTGCAAAGGTCACAGGG + Intergenic
1114712097 14:24789032-24789054 TCATCTGTACAAAAGGGACAAGG - Intergenic
1118352441 14:64982860-64982882 TCAACTGTGCAAATATTGCTGGG + Intronic
1122375811 14:101256391-101256413 TCATCTCTGCAAAAGGAGCTGGG + Intergenic
1125418739 15:39480949-39480971 TCATCTGTGCAAAAAGAGAAGGG - Intergenic
1125650050 15:41309424-41309446 TCCTCTGATCTAAAGTTGCATGG - Exonic
1125869322 15:43084314-43084336 TCATGTCTCCAAAAGTTTCATGG - Intronic
1129937779 15:79464981-79465003 ACATCTTTGCAAAGTTTGCAGGG + Intronic
1131472167 15:92706915-92706937 TCCTCTGTGCGCAACTTGCACGG - Intronic
1131703828 15:94971127-94971149 AAATCTGTGCAAAAATGGCAGGG + Intergenic
1134166075 16:11930652-11930674 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1134494643 16:14723077-14723099 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1134500026 16:14762197-14762219 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1134526569 16:14948815-14948837 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1134545835 16:15107530-15107552 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1134580554 16:15366855-15366877 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1134605093 16:15564046-15564068 TCATGTGTGCAGAAGTCACAGGG - Intronic
1134635230 16:15786751-15786773 TCATCTATGCACACGTTCCATGG + Intronic
1134714147 16:16347288-16347310 TCATTTGTGGGAAGGTTGCAGGG + Intergenic
1134722020 16:16390650-16390672 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1134945405 16:18321219-18321241 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1134952670 16:18361370-18361392 TCATTTGTGGGAAGGTTGCAGGG - Intergenic
1135311465 16:21408077-21408099 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1135364417 16:21840529-21840551 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1135447426 16:22530820-22530842 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1136150624 16:28345975-28345997 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1136166861 16:28459813-28459835 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1136196114 16:28655219-28655241 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1136212454 16:28769342-28769364 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1136257175 16:29049254-29049276 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1136308171 16:29387073-29387095 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1136321587 16:29488611-29488633 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1136436267 16:30228581-30228603 TCATTTGTGGGAAGGTTGCAGGG - Intronic
1140366866 16:74388589-74388611 TCATTTGTGGGAAGGTTGCAGGG + Intronic
1140889843 16:79275787-79275809 TCTTCTGTGCAAAAATGGAAAGG + Intergenic
1143614697 17:8042772-8042794 TCATCTCTGCAAAACTGCCAGGG - Exonic
1144185042 17:12789388-12789410 TCCTCTGTCCAAAGTTTGCAAGG - Intergenic
1144272526 17:13631984-13632006 TCATCTGTGTAAAAGTTGCAAGG - Intergenic
1144369799 17:14579224-14579246 TCATCTGTGAAAATGTGGCGGGG + Intergenic
1149553263 17:57555513-57555535 TAATATGTGCAAAAGTTGACAGG - Intronic
1149906109 17:60527828-60527850 TTATCTCTGCAAATATTGCAGGG + Intergenic
1154117336 18:11622697-11622719 TCATTTGTGGGAAGGTTGCAGGG - Intergenic
1156396070 18:36700959-36700981 CCAACTGTGCACAAGATGCAAGG - Intronic
1156831466 18:41497204-41497226 TCATATCTGCAAAAATTGTAAGG + Intergenic
1159933867 18:74344458-74344480 TCATCTGTGTGATAGTTACATGG - Intronic
1166182477 19:41118613-41118635 TTTTCTGTGCAAAAGTAGCAAGG - Intronic
1166189614 19:41167332-41167354 TCATCTGCCCAACAGGTGCAAGG - Intergenic
1167813095 19:51852357-51852379 ACACCTGTCCAAAAGTTGCAAGG + Intergenic
927582411 2:24264555-24264577 TAATCTGTGTATATGTTGCAAGG + Intronic
928113018 2:28525658-28525680 TCATCTGGTCCAAAGCTGCAAGG - Intronic
928235286 2:29533969-29533991 TGGACTGTGCAAAAGTTGAAGGG + Intronic
931982488 2:67709315-67709337 TCATCTGAGGAAAAATGGCATGG - Intergenic
932328900 2:70886028-70886050 TCCTCTGTGCAGAAGTAGCATGG - Intergenic
934988967 2:98907963-98907985 ACATCTCTGCAAATTTTGCAAGG + Intronic
937782307 2:125853067-125853089 ACTACTGAGCAAAAGTTGCAGGG + Intergenic
938481770 2:131668948-131668970 GCAGCTGTGCAAAACTTACAGGG + Intergenic
939168829 2:138670313-138670335 TCATCTGAGCTACAGTTGCGTGG - Intergenic
944910608 2:204306820-204306842 TCTTCTCTGCAGTAGTTGCAGGG - Intergenic
945079920 2:206078490-206078512 TCATATGTTCAAAAGTTTAAAGG - Intronic
945414102 2:209549281-209549303 TCATCTGTGAAAGAGAGGCATGG - Intronic
946582486 2:221144661-221144683 GCATCTGTGCATAATTGGCAAGG + Intergenic
947321275 2:228921503-228921525 TCATCTGTTCACAAGTTGGTGGG - Intronic
1170894545 20:20401888-20401910 TTATCCGTGCCAAAGTGGCATGG + Intronic
1171282058 20:23909577-23909599 TCATTAGTGCAAAGGTGGCAAGG + Intergenic
1171467939 20:25344855-25344877 TCATCTGTGACAAAGGAGCAAGG + Intronic
1174466003 20:50717969-50717991 TCATCTCTGCAAAATTAGCCAGG - Intergenic
1175516442 20:59573487-59573509 TCACTTGTCCACAAGTTGCAGGG + Intergenic
1177574864 21:22939764-22939786 TCATCAATGCAAAAGTATCAAGG - Intergenic
1178987254 21:37317114-37317136 TCATCTGTACAAAAATTAGACGG + Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
955501953 3:59594274-59594296 TCCTCTGTCCAAATGATGCAAGG + Intergenic
957120913 3:76090927-76090949 TAATCTGTGGAAGAGTTGTAAGG - Intronic
959995624 3:112677307-112677329 GCAGCTGTGCAAAGCTTGCAAGG + Intergenic
963064297 3:141251451-141251473 ACATCTCTACAACAGTTGCAAGG + Intronic
965744587 3:171911470-171911492 TCATCTTTTCAAATGTTGCTGGG + Intronic
968984546 4:3867979-3868001 TCTTCTGTGCTAAAGTGGAAAGG + Intergenic
970798765 4:19947102-19947124 GCAAATGGGCAAAAGTTGCAAGG - Intergenic
972506517 4:39725034-39725056 GCATTTGTGCAATACTTGCAAGG - Intronic
974167352 4:58220826-58220848 TCATCTGTGACAAAGGTGCCAGG + Intergenic
975920069 4:79375218-79375240 TCACTTGTGCAAAGGTTGGATGG - Intergenic
976092849 4:81474835-81474857 TCCTCTGTGCTAAAGGAGCATGG + Intronic
976989962 4:91353883-91353905 GCATCTGTGCCACACTTGCATGG + Intronic
977702892 4:100040290-100040312 TCATCTGAGCAGTAGTTACATGG - Intergenic
978763432 4:112379772-112379794 TCATCTCTGGAGAAGTTGCTGGG - Intronic
981182484 4:141762697-141762719 TCATCTTTGGTAAAGTAGCAGGG + Intergenic
984421575 4:179529186-179529208 TAATCTGTGCAAAGGATACAAGG - Intergenic
986376134 5:7133326-7133348 TCATTTGTTAAAAGGTTGCATGG + Intergenic
987111512 5:14691979-14692001 TCATCTGTTCAATAGTTTGATGG + Intronic
988606611 5:32684077-32684099 TCAGCTTTCCACAAGTTGCAGGG - Intergenic
988811160 5:34786540-34786562 TCATTTGTGAAAAGGTTCCAAGG + Intronic
995980954 5:118103755-118103777 GGATCTCTACAAAAGTTGCATGG + Intergenic
996291796 5:121860248-121860270 TTATCTGTGAAAAAGTTCCAAGG + Intergenic
996375377 5:122800831-122800853 TCAACTTTGCAAAATTTTCAAGG - Intronic
997474480 5:134134616-134134638 TCCTCTGTCCTAAAGTTCCAGGG - Intronic
999986013 5:157006150-157006172 TCATCTCTGCAGGCGTTGCATGG + Intergenic
1002891201 6:1333972-1333994 TCATCTGTGCAAAGAGTGCAAGG + Intergenic
1004554649 6:16683857-16683879 TTATCTGTGCCCAAGCTGCAGGG + Intronic
1008143107 6:47855104-47855126 TCATCTGAGCAATTGTTGAAAGG - Intergenic
1008560533 6:52720552-52720574 TCTTCTGGGCAAAATCTGCATGG + Intergenic
1010673658 6:78716920-78716942 TAACCTGTGCAAAACATGCATGG + Intergenic
1011309749 6:85968753-85968775 TCACCTGTGTAAAAGTAGCAAGG - Intergenic
1012610043 6:101206279-101206301 TCCTCTCTGGAAAACTTGCAGGG + Intergenic
1013656224 6:112249532-112249554 TCAACTGTGCAAAAGTAGCTAGG - Intronic
1014285572 6:119493630-119493652 TAATCAGTGTAAAAGTGGCATGG - Intergenic
1014340492 6:120200147-120200169 TCTTCTTTGCAAAAGGTACAAGG + Intergenic
1014631020 6:123789975-123789997 TCATCCGAGTAAAAGTGGCAAGG + Intergenic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1018446264 6:163861903-163861925 TCAAGTGTGGAAAAGTTACACGG + Intergenic
1023127421 7:36969061-36969083 GCATTTTTGAAAAAGTTGCATGG + Intronic
1023774895 7:43596178-43596200 TCATCTGTGATAATGTTGCCAGG + Intronic
1024987859 7:55211440-55211462 TCATCATTGCAAAACTTTCAAGG - Exonic
1027633000 7:80631084-80631106 TGAGCAGTGCAAAAGTAGCAGGG + Intronic
1027723735 7:81776443-81776465 TCATGTGTGTAAAAATAGCAGGG + Intergenic
1028509752 7:91610882-91610904 CTACCTGTGGAAAAGTTGCAAGG + Intergenic
1031448856 7:121889297-121889319 TCTTCTGTGCAAAAGCAGAAAGG + Intronic
1031890470 7:127287894-127287916 TCTTGGGTGCAAGAGTTGCATGG - Intergenic
1033940881 7:146651751-146651773 TCATCTGGGCATAAATTGCAAGG + Intronic
1037229623 8:16641082-16641104 TGATTTGTGTAAAAGATGCAGGG + Intergenic
1039144604 8:34433157-34433179 TCATCAGTGCAAAAGTTTCAGGG - Intergenic
1039289130 8:36075049-36075071 TCATTTGTACAAAAGATGCTAGG - Intergenic
1039594449 8:38778742-38778764 CCATCTGGGAAAAAGTAGCAAGG - Intronic
1041292231 8:56318932-56318954 TCATTTCTACCAAAGTTGCAGGG - Intronic
1041521281 8:58759099-58759121 ACAACTTGGCAAAAGTTGCATGG + Intergenic
1041648569 8:60279034-60279056 TGTTCTGTGCAAAAGTTGTTAGG - Intronic
1041936673 8:63339723-63339745 TCATCTATGTAAAATTTACAAGG - Intergenic
1045329156 8:101140555-101140577 TCATTTGTGCAAATGTTCAATGG - Intergenic
1046615808 8:116475954-116475976 CCAGCTGAGTAAAAGTTGCAGGG + Intergenic
1048028969 8:130613122-130613144 TCCTCTGTGCAGTAGATGCAAGG + Intergenic
1048746767 8:137623273-137623295 ACATTTGTGCAAAAGTCGTATGG + Intergenic
1052735244 9:32335098-32335120 TCATCTGTGCACAGGCTGCCTGG + Intergenic
1055997239 9:82173067-82173089 TCATCTGTTCTAATGTTCCAGGG - Intergenic
1056619085 9:88195480-88195502 GCATCTGTGCAGAATCTGCACGG - Intergenic
1056844363 9:90024761-90024783 TAAACTGTGCTAAAGCTGCATGG + Intergenic
1058246966 9:102639041-102639063 TCATCTGAGAAAATGTTGCAGGG + Intergenic
1060379033 9:123147980-123148002 TGATCAGTGAAAAAGTTGTATGG - Intronic
1062571327 9:137186810-137186832 TCATCCCTGCAAAAGTTACACGG - Intronic
1192155784 X:68745589-68745611 TCATCTGTGAAATGGGTGCAGGG + Intergenic
1194840615 X:98736463-98736485 CCATCTGTGGAAAGGCTGCAGGG + Intergenic
1196062829 X:111429936-111429958 TCATCTTTGTATAAATTGCAAGG - Intergenic
1198088565 X:133304785-133304807 TCATCGTTGCAAACGTTGCTCGG + Exonic
1200757602 Y:7004911-7004933 CCAACTGTGCATAAGTAGCAAGG - Intronic
1202267446 Y:23034818-23034840 TCATCACTGAAAAATTTGCAGGG + Intergenic
1202420438 Y:24668562-24668584 TCATCACTGAAAAATTTGCAGGG + Intergenic
1202450348 Y:25001520-25001542 TCATCACTGAAAAATTTGCAGGG - Intergenic