ID: 1075395571

View in Genome Browser
Species Human (GRCh38)
Location 10:122124550-122124572
Sequence CTAGCTGGACACTTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075395571_1075395583 11 Left 1075395571 10:122124550-122124572 CCCAGCCCCAAGTGTCCAGCTAG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1075395583 10:122124584-122124606 GCTGCCTGATGCTGCCGAAGTGG No data
1075395571_1075395585 15 Left 1075395571 10:122124550-122124572 CCCAGCCCCAAGTGTCCAGCTAG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1075395585 10:122124588-122124610 CCTGATGCTGCCGAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075395571 Original CRISPR CTAGCTGGACACTTGGGGCT GGG (reversed) Intronic
903204366 1:21769637-21769659 GTAGGTGGACACTTGAGGCCAGG - Intronic
904585427 1:31577188-31577210 CTGGCTGGCCACTTGGCTCTGGG + Exonic
905469733 1:38182807-38182829 CTGCCTGGACTCTTGGGGATTGG + Intergenic
905794557 1:40808257-40808279 CTTGGTGGATACTTGGGGGTGGG + Intronic
906611845 1:47209176-47209198 TTGGCTGGGGACTTGGGGCTGGG + Intergenic
907015677 1:51010476-51010498 CAGGCTGGTCACTTGGGGCCAGG - Intergenic
908723192 1:67148054-67148076 CGAGCTGAACACTAGTGGCTGGG - Intronic
911309770 1:96278017-96278039 CAAGCTGGAAACTGGGGACTTGG + Intergenic
911461191 1:98193276-98193298 TGAGTTGGACACTTGAGGCTTGG - Intergenic
912463373 1:109852422-109852444 CTAGCTGAACACTAGTCGCTGGG - Intergenic
912683102 1:111741233-111741255 CCAGAGGGACACTTGGGGCTAGG - Intronic
912688004 1:111782156-111782178 CCAGCAGGACACTTGGGGAGAGG - Intronic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
916303809 1:163306057-163306079 TTATCTGAAAACTTGGGGCTTGG + Intronic
917845252 1:179015038-179015060 AAACCTGGCCACTTGGGGCTAGG + Intergenic
919781269 1:201222666-201222688 CTTGCTGGGGACCTGGGGCTGGG + Intronic
921634840 1:217480057-217480079 ATAGCTGGAGACTTTGGTCTGGG + Intronic
922618646 1:226977735-226977757 CTGGGTGGCCACTTTGGGCTGGG - Intronic
924289871 1:242525280-242525302 CTAGGTGGACACCGAGGGCTGGG - Intergenic
924839882 1:247697663-247697685 CTAGCAGGACACTTGGGGACTGG - Intergenic
1063206833 10:3840336-3840358 CTAGCTTGACTGTTGGGGCCAGG - Intergenic
1063415440 10:5869408-5869430 CTTGCTGGACACAGGTGGCTGGG - Intronic
1065268224 10:23999527-23999549 CTACCTGGACACTGGTGGCCAGG + Intronic
1067163088 10:43843399-43843421 CAAGCTGGATGCTGGGGGCTGGG + Intergenic
1067344130 10:45425816-45425838 CCACCTGGACACCTGGGGATAGG - Intronic
1074101094 10:110355369-110355391 GTAGCTGGAGACCTGGGGCCTGG - Intergenic
1074157344 10:110810471-110810493 CTGCCTGGAGACTTGGGGCTTGG - Intronic
1074669551 10:115774110-115774132 CTAACTCCACACCTGGGGCTGGG - Intronic
1075087435 10:119422967-119422989 CTACCTGGACACTGGTGGTTTGG - Intronic
1075395571 10:122124550-122124572 CTAGCTGGACACTTGGGGCTGGG - Intronic
1075907257 10:126092450-126092472 TTTGCTGGACATTTGGGGCAAGG - Intronic
1075979902 10:126729081-126729103 TTAGCTGGACAGTTCTGGCTTGG - Intergenic
1076229428 10:128807914-128807936 GTTGCTGGACACTGGGGCCTGGG - Intergenic
1076249574 10:128974863-128974885 CTTGTTGGTCACCTGGGGCTTGG - Intergenic
1077173579 11:1178946-1178968 CCAGCCGGCCACTTGGGGATGGG + Intronic
1077376316 11:2206425-2206447 CTAGATGGGCCCTTGAGGCTTGG - Intergenic
1078191457 11:9094939-9094961 GTAGCTGGACACTCTGGGCCAGG + Intronic
1079015726 11:16867070-16867092 ATGGATGGACACTTGGGGGTGGG + Intronic
1081774360 11:45667211-45667233 CTAGTGGGACCCTTGGGGCAAGG - Intergenic
1083334421 11:61914430-61914452 GGTGCTGGACACTTGGGACTTGG - Intronic
1084013645 11:66366306-66366328 GGAGCAGGACACTTGGGGCCTGG + Intronic
1084325468 11:68397431-68397453 GCAGCTGGGCACATGGGGCTGGG - Intronic
1085485436 11:76859812-76859834 GTAGCTGAACACTAGGGGCAAGG + Intergenic
1089000755 11:115050272-115050294 CAAGCTGGAGACGTTGGGCTGGG - Intergenic
1089005001 11:115083891-115083913 GTAGCTGGACACACTGGGCTTGG - Intergenic
1089640591 11:119844954-119844976 CTTGCTGGAAACTTGGGTCTCGG - Intergenic
1091200982 11:133781198-133781220 GTAGATGCACATTTGGGGCTGGG - Intergenic
1091457592 12:619210-619232 CAAGCTGGGCACTTGGGGTAGGG + Intronic
1093587429 12:20856785-20856807 CTAGCAGATCACTTGAGGCTAGG - Intronic
1094363348 12:29653463-29653485 CTAAATGGACAATTGGGCCTTGG + Intronic
1096626850 12:52901116-52901138 CTATCTGGACACTGGAGGCTGGG - Intronic
1098362896 12:69672444-69672466 CCAGCTGGACACTGGGAGCCTGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1108444472 13:50493613-50493635 TGAGCTGGCCACTTAGGGCTTGG + Intronic
1114032110 14:18586981-18587003 CTAGGTAGACACCTGGGGCTTGG + Intergenic
1114076889 14:19166011-19166033 CTAGGTAGACACCTGAGGCTTGG + Intergenic
1114085271 14:19233557-19233579 CTAGGTAGACACCTGAGGCTTGG - Intergenic
1117128579 14:52660059-52660081 CTGGCTGGTCACTTGAGGCCAGG - Intronic
1121414328 14:93768536-93768558 CTAGTTGGACACTTGAGCCCTGG - Intronic
1121744226 14:96275454-96275476 CTCGCTGTAAACATGGGGCTGGG - Exonic
1126311238 15:47319372-47319394 ATAGCTGGACATTTTGGACTTGG + Intronic
1126675540 15:51156831-51156853 CTTATTGCACACTTGGGGCTTGG + Intergenic
1126700576 15:51363145-51363167 GTAGCTGCATACTTGGGTCTGGG + Intronic
1126885257 15:53142208-53142230 CTAGAGGGGCACTTGGAGCTTGG + Intergenic
1128129195 15:65214541-65214563 CGCACTGGCCACTTGGGGCTAGG - Intergenic
1128980234 15:72180334-72180356 TTGGCAGGCCACTTGGGGCTTGG + Intronic
1129517131 15:76163610-76163632 CCAGCTGGCCACTTGGAACTGGG + Intronic
1131097906 15:89667451-89667473 CCAGCTGGGCATTTGGGGGTGGG + Intronic
1134098089 16:11432633-11432655 CTTGCTGGAAAATTGGGGCAGGG + Intronic
1135221842 16:20621049-20621071 GCAGCAGGACACTTGGGGCAGGG + Intronic
1136115859 16:28093910-28093932 CTAGCTGGCTCCTTGGGCCTGGG - Intergenic
1138480099 16:57297120-57297142 TTAGCCGGACCCCTGGGGCTAGG - Intergenic
1139263553 16:65618689-65618711 ATAGCTGTACAGCTGGGGCTGGG - Intergenic
1140426341 16:74864842-74864864 CCAGCTGGACACTTGAGGTCAGG + Intergenic
1142023582 16:87800149-87800171 ATAGCAGAACACTGGGGGCTGGG + Intergenic
1143844885 17:9766547-9766569 TTAGCTGGGCAGTTGGTGCTGGG + Intergenic
1145347235 17:22048834-22048856 CTAGTTGGACACTAGGCCCTAGG - Intergenic
1146163870 17:30573582-30573604 CCAGATGGACACTCGGGGCATGG + Intergenic
1146927008 17:36752171-36752193 CTAGCTGGGCACTGGGGACAAGG - Intergenic
1147584410 17:41645511-41645533 CTAACTGAACACTTGAGACTGGG - Intergenic
1147835780 17:43330665-43330687 CTTGCTGGACGCCAGGGGCTCGG + Intergenic
1149003426 17:51779850-51779872 AAGGCTGGAAACTTGGGGCTGGG + Intronic
1149990112 17:61378412-61378434 CTTGCTGGATACTTGGCCCTGGG + Intronic
1150872920 17:68934005-68934027 CTAGTTAGAAACTTGGTGCTGGG - Intronic
1151423260 17:74012779-74012801 CCAGCTGGACACTCAGGCCTGGG - Intergenic
1151519396 17:74617481-74617503 CTGGATGGAGACTTGGGACTCGG - Intronic
1151574294 17:74943939-74943961 CTAGCTGGACACCTGGAGTTGGG - Intronic
1151757284 17:76082082-76082104 CTAGGTGCACACCTAGGGCTGGG + Intronic
1152130187 17:78471876-78471898 ACAGCGGGACACATGGGGCTGGG - Intronic
1155972063 18:32092309-32092331 CGGGCTGGGCACTCGGGGCTCGG + Intronic
1156503096 18:37572164-37572186 CTAACAGGCCACTGGGGGCTGGG + Intergenic
1157291959 18:46415983-46416005 CCAGCTGGCCACTCAGGGCTGGG + Intronic
1157422075 18:47555781-47555803 CAAGCTGGAGACATGGGGCAAGG - Intergenic
1159986033 18:74841818-74841840 CAAGCTGGATACTTGAGTCTAGG - Intronic
1161190540 19:2952475-2952497 CTAGCTGCACATGTGGGGCCTGG - Intergenic
1161256903 19:3314771-3314793 CTTGCTGGACACGGGGGGCCCGG - Intergenic
1163659629 19:18568879-18568901 CCAGCTGGAGTCGTGGGGCTGGG + Exonic
1166695799 19:44851000-44851022 GAAGCTGGACACCTGGGTCTAGG - Intronic
1168485672 19:56760085-56760107 CTGGCTTGGCATTTGGGGCTTGG - Intergenic
929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG + Intergenic
930356306 2:50325013-50325035 CTAGCAGAACATTTGGGACTGGG + Intronic
934713334 2:96529410-96529432 CTAGCTGGAGACGAGAGGCTCGG + Intergenic
936437703 2:112522453-112522475 ATGGCTGGACACGTGGTGCTGGG + Intronic
937808099 2:126169391-126169413 CTAGCTGGAGGTTGGGGGCTAGG + Intergenic
938146480 2:128838861-128838883 CTAGCTAGACTCTTGAGTCTGGG + Intergenic
938189988 2:129269744-129269766 CCTTCTGGAAACTTGGGGCTTGG - Intergenic
938408058 2:131043698-131043720 CTGGCCAGACCCTTGGGGCTGGG + Intronic
938491489 2:131763521-131763543 CTAGGCAGACACCTGGGGCTTGG + Intronic
938911545 2:135889889-135889911 GTAGTTGGACACTTGGGATTGGG - Intergenic
941395536 2:164968737-164968759 CGAGCTGAACACTAGTGGCTGGG - Intergenic
944647651 2:201795630-201795652 CCAACTGGATACTAGGGGCTGGG + Intronic
945258281 2:207820577-207820599 CTAGCTGGCCACCTGGCACTTGG + Intergenic
1169462858 20:5811557-5811579 CAAGCTGGAGACCTGAGGCTGGG + Intronic
1172748339 20:37231174-37231196 CCAGCTGGAAAATTGGGGGTGGG - Intronic
1172867637 20:38112454-38112476 CGAGCTGAGCTCTTGGGGCTGGG + Intronic
1173335218 20:42106997-42107019 CCAGCAGGACCCTTGGGGATAGG - Intronic
1173592414 20:44235063-44235085 CTAGCTGGGGATTTGGGGCCAGG + Intergenic
1173848560 20:46203169-46203191 CTAGCTAAAGACCTGGGGCTGGG + Intronic
1174778152 20:53364527-53364549 CTGGCTGGACAAGTGGGGCTGGG - Intronic
1175499349 20:59438891-59438913 CTGGCTGGACAGCTGGGGCCAGG - Intergenic
1176708602 21:10132371-10132393 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1177207084 21:18022630-18022652 GTAACTAGACACTTGTGGCTGGG - Intronic
1179461245 21:41536726-41536748 CTCGCTGGAAACTGGGGGCCTGG - Intergenic
1180074956 21:45457534-45457556 CTGGCTGGACAGTTGGGGGCAGG + Intronic
1180137414 21:45870763-45870785 CTAGCTGGACACACGCAGCTGGG - Intronic
1180144218 21:45910314-45910336 CTAGCTGGTCACATGGTTCTGGG + Intronic
1180292700 22:10859636-10859658 CTAGGTAGACACCTGAGGCTTGG + Intergenic
1180456224 22:15514038-15514060 CTAGGTAGACACCTGGGGCTTGG + Intergenic
1182524535 22:30907105-30907127 CTTCCTGGCCTCTTGGGGCTAGG - Exonic
1184038313 22:41928905-41928927 CAAGCTGGAAACCTGGGGGTCGG - Intergenic
1184131089 22:42516830-42516852 CGAGCTGGACACTTGCCACTGGG + Intronic
1184141261 22:42578689-42578711 CGAGCTGGACACTTGCGACTGGG + Intergenic
1184562724 22:45272748-45272770 ATAGCTGGACACTAGGAGCCTGG - Intergenic
1185271482 22:49931281-49931303 CTCACTGCACACCTGGGGCTGGG + Intergenic
950112806 3:10430870-10430892 CTTGGTGGCCTCTTGGGGCTTGG + Intronic
951386219 3:22045923-22045945 CTAGCTCTACACCTGGGGCTTGG - Intronic
954397794 3:50302260-50302282 CTAGCTGGTCATTTTGGGCACGG + Exonic
955185965 3:56715401-56715423 GAAGATGGACAGTTGGGGCTGGG - Intergenic
955587671 3:60499148-60499170 AGACCTGGACCCTTGGGGCTGGG + Intronic
957166178 3:76676673-76676695 CTAGCAGAACACTTGGGGCATGG - Intronic
961327212 3:126116107-126116129 CCAGCTGGTCACTTGAGGCCAGG - Intronic
962299220 3:134222972-134222994 CTGGCTGGAGGCTTGAGGCTTGG - Intronic
962740587 3:138360430-138360452 TTAGCTGTACTCTGGGGGCTGGG + Intronic
965564616 3:170100982-170101004 CTATGTGGATACCTGGGGCTGGG - Intronic
966807585 3:183819042-183819064 CTAGCTGGACACTTCCACCTTGG - Intronic
967893984 3:194382469-194382491 CAAGCTGGACATGAGGGGCTGGG - Intergenic
979062206 4:116078095-116078117 AAAGCTGAACCCTTGGGGCTGGG - Intergenic
982332149 4:154192656-154192678 CGAGCTGAACACTAGTGGCTGGG + Intergenic
985595482 5:785761-785783 CCTGCTGGACACCTGGGGCAGGG - Intergenic
988485828 5:31667487-31667509 CTTGCTGGATAGTGGGGGCTGGG + Intronic
994115645 5:96059005-96059027 TTAGCTGGAAACATGGGGCAAGG + Intergenic
999394328 5:151217390-151217412 ATTGCTGGCAACTTGGGGCTGGG + Intronic
1001509064 5:172305086-172305108 CTAGCAGATCACTTGAGGCTAGG + Intergenic
1002198176 5:177512424-177512446 ATCGCTGGACACTAGGGGCCTGG + Intronic
1006936994 6:37725515-37725537 ATAGCTGGAGACTTGTGGTTAGG - Intergenic
1009878253 6:69533240-69533262 CTGGCTGGAGGCTGGGGGCTTGG - Intergenic
1010532614 6:76987754-76987776 CTAGCTTGTTACTTGGTGCTAGG + Intergenic
1016820216 6:148340073-148340095 CAAGCCGGGCAGTTGGGGCTGGG - Intronic
1017268697 6:152480927-152480949 CTAGCTGTATTCTTGGGGGTTGG + Intronic
1018488663 6:164269584-164269606 CTAGTTGGAAACCTGGGTCTTGG + Intergenic
1021898733 7:25262500-25262522 CTTGGTCGATACTTGGGGCTGGG - Intergenic
1025280820 7:57625634-57625656 CTAGTTGGACACTAGGCCCTAGG + Intergenic
1025303910 7:57839873-57839895 CTAGTTGGACACTAGGCCCTAGG - Intergenic
1027387523 7:77673216-77673238 GTAGATGGTCACTTGGGCCTAGG + Intergenic
1029616973 7:101665194-101665216 TTAGCTGAACAATGGGGGCTCGG - Intergenic
1033029193 7:137808564-137808586 CTGCCTGGACAGTGGGGGCTAGG - Intronic
1036814745 8:11893491-11893513 CAAGCGGGTCACTTGAGGCTAGG - Intergenic
1037881942 8:22577886-22577908 GCAGCTGTGCACTTGGGGCTAGG + Intergenic
1038054910 8:23849120-23849142 CTAGCATGAGATTTGGGGCTGGG - Intronic
1039597722 8:38805935-38805957 AGAGATGCACACTTGGGGCTTGG + Intronic
1039802813 8:40974670-40974692 CTAGCTGCACGAGTGGGGCTGGG + Intergenic
1045615295 8:103902064-103902086 CTATCTGGACACTTGATGCAGGG + Intronic
1046887875 8:119388268-119388290 CAAGCTGGACACTTGTCACTGGG + Intergenic
1049645282 8:143733351-143733373 CTAGCTGGAGTCTGGGTGCTGGG - Intronic
1049880619 8:145059822-145059844 CTGGCTGGACGCTGGGGGCTGGG - Intergenic
1053760139 9:41345643-41345665 CTAGGCAGACACCTGGGGCTTGG - Intergenic
1054326592 9:63715785-63715807 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1060644015 9:125262375-125262397 CAAGCTGGACACACGGGTCTGGG + Intronic
1062012249 9:134273412-134273434 CTGGCTGTGCACTTGGGGCCTGG + Intergenic
1062359818 9:136182386-136182408 CTAGCTGTACCCTTGGGGTGGGG + Intergenic
1062383079 9:136296974-136296996 CCACCTGCACACTTGGGGGTGGG - Intronic
1202793363 9_KI270719v1_random:101340-101362 CTAGGCAGACACCTGGGGCTTGG + Intergenic
1187362109 X:18638060-18638082 CTTTCTGTCCACTTGGGGCTTGG - Intronic
1191955143 X:66636047-66636069 ATAGCTGGGCACTGGGTGCTGGG - Intronic
1192332399 X:70186877-70186899 CTAGGAAGACACGTGGGGCTAGG + Intronic
1197972537 X:132130265-132130287 CAAGCTGGACACTGAGGGCATGG - Intergenic
1198800855 X:140446336-140446358 CCAGCTCCACACTTGGGTCTTGG + Intergenic
1200249504 X:154545229-154545251 CAAGCTGGACAATTGGGGCCAGG + Intronic