ID: 1075396061

View in Genome Browser
Species Human (GRCh38)
Location 10:122128035-122128057
Sequence ACTGCAAGGCAGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075396057_1075396061 -6 Left 1075396057 10:122128018-122128040 CCTGTTAGAAGCAGAGAACTGCA 0: 1
1: 0
2: 0
3: 22
4: 178
Right 1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG No data
1075396055_1075396061 14 Left 1075396055 10:122127998-122128020 CCATGTTTCTTAGCCTGTAGCCT 0: 1
1: 0
2: 1
3: 13
4: 219
Right 1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG No data
1075396056_1075396061 1 Left 1075396056 10:122128011-122128033 CCTGTAGCCTGTTAGAAGCAGAG 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075396061 Original CRISPR ACTGCAAGGCAGAAGGTGGC AGG Intronic
No off target data available for this crispr