ID: 1075396086

View in Genome Browser
Species Human (GRCh38)
Location 10:122128210-122128232
Sequence TTCCAGTCCAGGCCCACCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075396086_1075396090 3 Left 1075396086 10:122128210-122128232 CCCATGGTGGGCCTGGACTGGAA No data
Right 1075396090 10:122128236-122128258 AGTCCCCTCAACTTCACATACGG No data
1075396086_1075396092 6 Left 1075396086 10:122128210-122128232 CCCATGGTGGGCCTGGACTGGAA No data
Right 1075396092 10:122128239-122128261 CCCCTCAACTTCACATACGGTGG No data
1075396086_1075396095 16 Left 1075396086 10:122128210-122128232 CCCATGGTGGGCCTGGACTGGAA No data
Right 1075396095 10:122128249-122128271 TCACATACGGTGGTTACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075396086 Original CRISPR TTCCAGTCCAGGCCCACCAT GGG (reversed) Intronic