ID: 1075399205

View in Genome Browser
Species Human (GRCh38)
Location 10:122149496-122149518
Sequence TGCCCAGGGCGGGTGGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 1, 2: 4, 3: 56, 4: 644}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399205 Original CRISPR TGCCCAGGGCGGGTGGGGCC GGG (reversed) Intronic
900075339 1:811582-811604 TGCCCATAGGTGGTGGGGCCAGG + Intergenic
900077358 1:827994-828016 GGCCCAGGGCTGGAGGGGCCGGG + Intergenic
900140323 1:1137049-1137071 AGCCCAGGGCGGGGAGGGCGCGG + Intergenic
900149237 1:1171009-1171031 TGCGCAGGGCAGGTGGGAGCAGG - Intergenic
900186379 1:1335029-1335051 AGCCCAGGTGGGGTGGGGGCGGG + Exonic
900206300 1:1433307-1433329 TCCCAAAGGCGGGTGGGGGCAGG + Intergenic
900400757 1:2472006-2472028 TGCCCGGGGCCTGTGGGGCTGGG - Intronic
900534602 1:3170675-3170697 TGCCCAGAGGAGGCGGGGCCCGG + Intronic
900589137 1:3452052-3452074 GGCCCATGGCTGGGGGGGCCGGG - Intergenic
900607647 1:3531039-3531061 TGGGCAGGGCGGGCGGGGCCAGG - Intronic
900659239 1:3774595-3774617 TGCCCAGAGCAGGAGGGGCCCGG - Intronic
900940040 1:5792844-5792866 TGGCCAGGGAGGGTTGTGCCTGG + Intergenic
901082574 1:6591861-6591883 TGTCCAGGCCTGCTGGGGCCTGG - Exonic
901159237 1:7162464-7162486 TGCCCTGGGCTGGAGGGGCTGGG - Intronic
901768593 1:11519288-11519310 TACCCAGGGAGGGTGGGGCAGGG - Intronic
901835648 1:11922538-11922560 TGGCGAGGGGGGGTGAGGCCTGG - Intronic
901920078 1:12529717-12529739 TGCCCAGGAAGGGTGGACCCAGG - Intergenic
901920342 1:12531690-12531712 TACCCAGGAGGGGTGGGTCCAGG - Intergenic
902399609 1:16150800-16150822 GGCCCAGGGAGCGTGGGGCCTGG - Intronic
902871742 1:19317764-19317786 TGCCCAGGACGGCTGGGACGAGG + Exonic
903183090 1:21614871-21614893 TTCCTGGGGCGGGTGTGGCCGGG - Intronic
903193693 1:21669906-21669928 GGCCCAGGGCGGGTGTGGGGAGG + Intergenic
903349777 1:22710787-22710809 TGCCCAGCGCTGGCGGAGCCCGG + Intergenic
903363476 1:22792064-22792086 AGCCAAGGGAGGGAGGGGCCAGG + Intronic
903467156 1:23559580-23559602 CGCCCAGGGCCGGCGGGGGCAGG - Exonic
903493084 1:23743902-23743924 TGCCCGGGGCGGGAGGGCGCTGG + Intronic
903814064 1:26051773-26051795 GGCCCAGGGTGGGAGGGGTCGGG - Exonic
903969783 1:27111108-27111130 TGGCCAGGCCTGGTGCGGCCTGG + Intronic
904306469 1:29593250-29593272 AGCCCAGGGCAGGTGTGTCCAGG - Intergenic
905458008 1:38101741-38101763 TGCCCAAGGTGGGTGGAGCTGGG + Intergenic
905899576 1:41572436-41572458 TTCCCGGAGTGGGTGGGGCCGGG - Intronic
905913296 1:41668515-41668537 TGCCCAGGAAGGGAGTGGCCTGG + Intronic
905995283 1:42376009-42376031 AGCGCAGGGAGGGTGGGGCAGGG + Intergenic
906477568 1:46180363-46180385 TGCCCAGGGCTGGTGTTGCCAGG + Intronic
906678237 1:47708625-47708647 TGCCCAGGGAGGGGAAGGCCAGG + Intergenic
907304627 1:53506845-53506867 TGGGCAGGCGGGGTGGGGCCTGG - Intronic
907326564 1:53642094-53642116 GGCCCAGAGCTTGTGGGGCCAGG + Intronic
907401719 1:54228705-54228727 TGCCCAGGCAGGGTGGGGCATGG + Intronic
907923321 1:58933040-58933062 TGTGCATGGAGGGTGGGGCCAGG - Intergenic
908703936 1:66930435-66930457 GGCCCAGGGCCGGGGGCGCCCGG - Intronic
910086818 1:83412841-83412863 TGCCGAAGGCCAGTGGGGCCTGG + Intergenic
910258738 1:85276257-85276279 TGCCCAGGGCGGGCGGGGGCGGG - Intronic
910448929 1:87328235-87328257 TGACCCGGGCGCCTGGGGCCGGG - Intergenic
912797515 1:112701836-112701858 TGCCCAGGGTAGCTGGGGCCTGG - Intronic
913201084 1:116495776-116495798 AGTCGAGGGTGGGTGGGGCCTGG - Intergenic
914824726 1:151132684-151132706 TGAGCAGGGCAGGGGGGGCCCGG + Exonic
915253501 1:154608025-154608047 TGCCGCCGGCGGGTCGGGCCGGG - Exonic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
915891992 1:159781384-159781406 AGCGCAGGGAGGGAGGGGCCTGG + Intronic
917981431 1:180272008-180272030 TGAGCAGGGCTGGAGGGGCCAGG + Intronic
919870490 1:201817186-201817208 GGCCCACGGTGGGTGGGGGCAGG - Exonic
919978158 1:202626234-202626256 TGCAGAGGGAGGGTGGGGGCTGG - Intronic
919980531 1:202640250-202640272 TGCCAAGGCTGGGTGGGGCGGGG - Intronic
920051882 1:203169209-203169231 TGCCCTGGGCTGGTGGGGGCAGG - Intronic
920093680 1:203472019-203472041 AGTCCAGGGTGGGTGGGGTCTGG - Intergenic
920113195 1:203601349-203601371 AGCCCAGGGCCGGTGAGGCAAGG - Intergenic
920309759 1:205042133-205042155 TGCCCAGGAAGGCTGTGGCCCGG - Intergenic
920854732 1:209653180-209653202 TGCCTAGGGAGGGAGGGGCTAGG - Intergenic
922271179 1:224036459-224036481 TGCCCATAGGTGGTGGGGCCAGG + Intergenic
922718355 1:227888199-227888221 TCCCCAAGGCGGTGGGGGCCAGG + Intergenic
922743670 1:228031014-228031036 CCTCCAGGGCTGGTGGGGCCTGG + Intronic
922757150 1:228102833-228102855 TGCCGGGGCAGGGTGGGGCCGGG - Intronic
922875536 1:228937176-228937198 TGCCCAGGGTGGTTGGGGACTGG - Intergenic
1062939606 10:1411353-1411375 CGCCCTGGGCTGGTGGGGACGGG - Intronic
1063465652 10:6242384-6242406 TGCCCAGGACGGGCCTGGCCAGG + Intergenic
1064158017 10:12919743-12919765 TGCCCGGGGTGGGTGGGGGGTGG + Intronic
1066649408 10:37640438-37640460 GGCCCAGGGAGGGGGCGGCCAGG + Intergenic
1067495519 10:46757188-46757210 TTCCCAGGGCCGGTGGGGGTGGG + Intergenic
1067599134 10:47583200-47583222 TTCCCAGGGCCGGTGGGGGTGGG - Intergenic
1067948795 10:50709785-50709807 TTCCCAGGGCCGGTGGGGGTGGG - Intergenic
1068707343 10:60091519-60091541 TGACCAGGGAGGGTGGGGGTGGG + Intronic
1068809069 10:61235298-61235320 TGCCCAAGGTGGTTGGGGCACGG - Intergenic
1069215354 10:65812312-65812334 TGCCCCGGGCCAGCGGGGCCCGG + Intergenic
1069800860 10:71080679-71080701 GGCCTAGGGTGGGTGGAGCCTGG - Intergenic
1069817703 10:71209151-71209173 GCCCCAGGCGGGGTGGGGCCAGG + Intergenic
1069895051 10:71675261-71675283 TGCCCAGGGAGGGAGGTGCTGGG + Intronic
1069956803 10:72057029-72057051 TGCCCAGGGAGGGGGTGGGCAGG + Intergenic
1069982297 10:72260934-72260956 TCCCGAGGGTGGGCGGGGCCAGG + Intergenic
1070198174 10:74177778-74177800 TCACCAGGACGGGTGGAGCCTGG - Intronic
1070355853 10:75639645-75639667 AGCACAGGGCGGGAGGGGGCTGG - Intronic
1070766483 10:79059490-79059512 TGCCCACTGCGGGAGGGGCTAGG + Intergenic
1070770201 10:79077930-79077952 TGCCCAGGTCATGTGGTGCCTGG + Intronic
1070841774 10:79492401-79492423 TGCAGAGTGCGGCTGGGGCCTGG - Intergenic
1070848238 10:79541368-79541390 TCTCCGGGGCAGGTGGGGCCAGG - Intergenic
1070925540 10:80218801-80218823 TCTCCGGGGCAGGTGGGGCCAGG + Intergenic
1071518954 10:86317138-86317160 TGCCCAGGGTGGGCAGGTCCGGG - Intronic
1071649809 10:87383684-87383706 TGGCCAGGGAGGGTGAGCCCTGG - Intergenic
1072826380 10:98610955-98610977 TGCCCATGACTGGTGGGGTCTGG + Intronic
1073439517 10:103544288-103544310 TGCCCATGTTGGGTGGGGCCAGG + Intronic
1073443303 10:103565347-103565369 TGCTCAGGCCGGGCCGGGCCTGG + Intronic
1074289491 10:112127758-112127780 TGCCCAGGTTCGGTGGGGGCAGG + Intergenic
1074433030 10:113409484-113409506 TGCCCATGGCTGGTGGGGAAGGG + Intergenic
1074732464 10:116393507-116393529 TGCCCGTGGCGGGTGGGTCGGGG - Intergenic
1074755857 10:116623738-116623760 TGGGAAGGGCGGGTGGGGGCAGG - Intronic
1074777843 10:116779329-116779351 AGACCAGGGCCAGTGGGGCCTGG + Intergenic
1075344903 10:121674834-121674856 GGTCCAGGGGAGGTGGGGCCAGG + Intergenic
1075399205 10:122149496-122149518 TGCCCAGGGCGGGTGGGGCCGGG - Intronic
1075637262 10:124037698-124037720 TTCCCAGTGTGGGTGAGGCCAGG - Intronic
1075903245 10:126060443-126060465 TGTCAAGGGCCGGTGGGGCAAGG + Intronic
1076572394 10:131441237-131441259 TGCCCAGGACAGGAGGGACCCGG - Intergenic
1076653125 10:132003715-132003737 TGCCCCGTGCGGGTGGCCCCAGG + Intergenic
1076738217 10:132468128-132468150 CTCCCAGGGCGGGAGGGGACGGG + Intergenic
1076859405 10:133133556-133133578 TGCCCAGGGAGGCAGGGGACGGG + Intergenic
1076887500 10:133269411-133269433 TGGCCAGCGCAGGTGGGGCTGGG - Intronic
1076895204 10:133308263-133308285 TGCTCAGGGCGTGTGGGGGAAGG - Intronic
1077069150 11:659945-659967 AACACAGGGCAGGTGGGGCCAGG + Intronic
1077094103 11:792111-792133 GTCCCACGGCGGGTGGGGCCTGG - Intronic
1077146850 11:1050285-1050307 TGCCCAGGCAGGGAGGGTCCAGG + Intergenic
1077331501 11:1985812-1985834 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1077342166 11:2031012-2031034 TGCCCAGGGCCTGTGGGCCTCGG - Intergenic
1077478728 11:2803150-2803172 TGCCCGTGGGGGGGGGGGCCCGG - Intronic
1077528488 11:3083551-3083573 TGAGCAGGGCTGGTGGAGCCTGG - Intergenic
1078651958 11:13203970-13203992 TGCCTAGGGCTGGGAGGGCCTGG + Intergenic
1079008764 11:16811474-16811496 TGCGCAGGGCAGGTGGAGGCTGG + Intronic
1079105938 11:17572475-17572497 TGGGCAGAGAGGGTGGGGCCTGG - Intronic
1079187412 11:18249522-18249544 AGCCCAGGGGGGCTGAGGCCAGG + Intergenic
1079251702 11:18791885-18791907 TGCGCAGGGCTGGCGGGGCGGGG + Intronic
1079400398 11:20102292-20102314 GGCCCAGGGTGGGTGGGTGCTGG + Intronic
1080907925 11:36565363-36565385 TGCTCAGGGGGGTTGGGGCTTGG + Intronic
1081536897 11:44002893-44002915 TGTCCAGGGCTGGAGGGGTCTGG + Intergenic
1081866158 11:46361798-46361820 TGCCTAGGGATGGTGGGGCCCGG - Intronic
1081871182 11:46383210-46383232 TGCCCAGGGCTGCTGTGACCAGG + Intronic
1083163131 11:60867775-60867797 TGGCCAGGGAGGCAGGGGCCAGG - Intronic
1083640854 11:64144581-64144603 AGCCAAGAGCAGGTGGGGCCGGG - Intronic
1083640869 11:64144622-64144644 AGCCAAGCGCAGGTGGGGCCGGG - Intronic
1083684941 11:64370266-64370288 TGGCCAGGGCGGGCAGAGCCAGG + Exonic
1083936499 11:65872532-65872554 TGGCCGGGGCGGGTGGGCCTGGG - Intronic
1084128803 11:67118546-67118568 TGCCCAGGGCGAGAGGGCGCAGG - Intergenic
1084150586 11:67286218-67286240 TGCCCAGGACGGGGCCGGCCAGG + Exonic
1084172130 11:67405810-67405832 GGCCCAGGGAGGCTGAGGCCTGG + Intronic
1084295785 11:68213005-68213027 GGGCCAGGGCGGGTGGGGCCGGG - Intronic
1084312899 11:68326985-68327007 TGTGCAGGGATGGTGGGGCCAGG + Intronic
1084544440 11:69807683-69807705 TGCTCAGGGCGGGCAGTGCCTGG - Intergenic
1084591718 11:70094253-70094275 TGACCAGGGAGGGTGGTGGCAGG + Intronic
1084608115 11:70184288-70184310 TGCCCAGGGTCTGTGGGGGCAGG - Intronic
1085028907 11:73257933-73257955 GGGCCAGTGGGGGTGGGGCCTGG + Intergenic
1085036063 11:73300815-73300837 CTCCCAGGGTGGGTTGGGCCTGG - Intergenic
1085039723 11:73319829-73319851 AGCCCAGGCCTGGTGGGGCAGGG + Intronic
1085055520 11:73401363-73401385 TACCCAGGGGGGGTAAGGCCAGG - Intronic
1085317276 11:75553275-75553297 TGCCCATGGGTGGTGGGGCGGGG - Intergenic
1085636522 11:78163471-78163493 TGCTCAGGAATGGTGGGGCCGGG + Intergenic
1085724345 11:78941450-78941472 TGCCGAGGGAGGGTGGGGGAAGG + Intronic
1089556231 11:119317191-119317213 TGCGCGGGGCGGGGCGGGCCCGG - Intronic
1089660859 11:119984076-119984098 TGGCAAGGGTGGGTGGGGCGGGG - Intergenic
1089681169 11:120119789-120119811 TGCACAGGGAGGGAGGGGACTGG - Intronic
1090490903 11:127159745-127159767 TGCTCAGGGCAGCTGGGCCCTGG + Intergenic
1090552494 11:127838287-127838309 TGCTGAGGAGGGGTGGGGCCAGG - Intergenic
1090820494 11:130337482-130337504 AGCCCACGCGGGGTGGGGCCGGG + Intergenic
1090868825 11:130725262-130725284 TGCCCAGGCAGGGTGGGGCTGGG - Intergenic
1091124322 11:133082299-133082321 TGCCCCAGCCGGGTGGAGCCCGG - Intronic
1091227685 11:133967405-133967427 TAGCCCGGGCGGGTGGGACCCGG - Intergenic
1091265885 11:134270680-134270702 TGCCCAGGAAAGATGGGGCCTGG + Intergenic
1091295606 11:134472101-134472123 AGCACTGGGCGGGTGGAGCCGGG + Intergenic
1202814482 11_KI270721v1_random:40988-41010 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1202825152 11_KI270721v1_random:86201-86223 TGCCCAGGGCCTGTGGGCCTCGG - Intergenic
1092783106 12:12005384-12005406 TGACCAGGGCGGGGGGGGGTGGG - Intergenic
1093057215 12:14567547-14567569 CGCCCTGGGCGGGGGGCGCCCGG - Intronic
1094357659 12:29595543-29595565 TGCCCAGGAAGGGAGGGACCTGG - Intronic
1096196356 12:49651340-49651362 TGGGCAGGGCTGGTGGGACCAGG - Intronic
1096214669 12:49792552-49792574 TGGACAGGAGGGGTGGGGCCTGG + Exonic
1096242538 12:49967103-49967125 TGCCCCGGGCTGGGGGAGCCGGG + Intergenic
1096466300 12:51848954-51848976 AGCCCAGGGGAGGTGGGGGCGGG - Intergenic
1096782197 12:53997903-53997925 AGCCCAGGGCGGCTGAGGACCGG - Intronic
1096783883 12:54006240-54006262 TGCTCAGAGCCAGTGGGGCCGGG - Intronic
1100186533 12:92145555-92145577 GGCCCGGGGCGGCTGGGGCTCGG + Exonic
1101471287 12:104999400-104999422 TGCCCAGGTGGGGTGCGTCCTGG - Intronic
1102390578 12:112545755-112545777 TCCCCAGGGCAGGGTGGGCCTGG + Intergenic
1102432451 12:112894188-112894210 TGGCCATGGCTGGTGGTGCCTGG - Intronic
1102501815 12:113358519-113358541 GGCCGAGGGCGGGCGGGGCCGGG - Intronic
1103324438 12:120111056-120111078 TGCACAGGGCGGGTGAGGCGAGG - Intronic
1103394285 12:120596124-120596146 TTCCCAGGGCTCCTGGGGCCTGG - Intergenic
1103702936 12:122856958-122856980 GGGGCAGGGTGGGTGGGGCCTGG + Intronic
1103703714 12:122860530-122860552 TGCCCTGGGTGGGGGGGGGCAGG + Intronic
1103949294 12:124542474-124542496 TGCCCAGGGCAGAGGTGGCCTGG - Intronic
1104020354 12:124988228-124988250 GGGCCAGGGCAGGTCGGGCCTGG - Intronic
1104692639 12:130838792-130838814 TCCTCAGGGCGGGTTGGGGCAGG - Intronic
1104727086 12:131084746-131084768 TGCCCAGGGCCCGTGGGCACTGG - Intronic
1104946053 12:132415314-132415336 GGCTCAAGGCTGGTGGGGCCAGG + Intergenic
1104988184 12:132609266-132609288 TGCCCAGGGCAGGTGGGGGTTGG + Intronic
1104990270 12:132620592-132620614 AGCGCAGGCAGGGTGGGGCCAGG + Intronic
1105022742 12:132828338-132828360 TGGCCAGAGCGAGTGGGGCCGGG - Exonic
1105220658 13:18323039-18323061 GGGCCAGGGCAGGTGGGGCAGGG + Intergenic
1105304911 13:19161553-19161575 TTCTCATGGTGGGTGGGGCCTGG - Intergenic
1105509272 13:21037816-21037838 GGACCAGGGCGGGTAGGGCCAGG + Intronic
1105771871 13:23619799-23619821 TGCCCAGGGAGGGTGGGGAAAGG + Intronic
1105854474 13:24362035-24362057 TGCCCAGGGCCCTTGGGGGCAGG - Intergenic
1106072306 13:26424482-26424504 TTACCCGTGCGGGTGGGGCCCGG - Intergenic
1106433353 13:29703285-29703307 TGCCCAGGGTGGATGGGAACGGG - Intergenic
1108575463 13:51786591-51786613 TTGCGGGGGCGGGTGGGGCCTGG - Intronic
1109246633 13:59962510-59962532 TGCCCAGGAGGAGTGTGGCCTGG - Intronic
1112046670 13:95604330-95604352 TCCCCAGGGCGGCAGGGGCAGGG - Intronic
1113432364 13:110261929-110261951 TGCACAGGGCAGGTGGGCACAGG + Intronic
1113653994 13:112056975-112056997 TCCCCAGGGCGGGTCCGGCACGG - Intergenic
1113804723 13:113106393-113106415 GGCCGTGGGGGGGTGGGGCCTGG + Intronic
1118012217 14:61621617-61621639 TGCCCAGTGCTGGTTGGGGCTGG + Intronic
1118843247 14:69528045-69528067 TGCCCAAGGATGGTGGGGCCAGG - Intronic
1118928161 14:70213003-70213025 TGCCCAGGGTGCTTGAGGCCTGG - Intergenic
1119764859 14:77181921-77181943 TGACCGGGGCTGGTCGGGCCGGG + Intronic
1119790624 14:77346573-77346595 TGCCAGGGGCAGGTGGGGCAGGG - Intronic
1121718312 14:96091719-96091741 GGGCCAGGGTGGGTGGGGCTGGG - Exonic
1121936338 14:98022769-98022791 TGCCCGGTCCAGGTGGGGCCAGG - Intergenic
1122093698 14:99356200-99356222 TGAGCAGGGCGGGTGGTCCCAGG + Intergenic
1122117399 14:99534769-99534791 TTCCCAGGGCTGGTGAGGGCAGG - Intronic
1122151465 14:99728309-99728331 TGCTCAGTACAGGTGGGGCCTGG + Intergenic
1122228520 14:100293266-100293288 TGGCCTGGGCTGGTGGGGCTCGG - Intronic
1122242246 14:100376515-100376537 GGCCCCGGGCTGGAGGGGCCGGG + Exonic
1122320302 14:100851481-100851503 TGCCCAGGGCTCCTGGGTCCCGG - Intergenic
1122329230 14:100901780-100901802 TGCCCAGGGCTGGTGGGGGGAGG - Intergenic
1122577256 14:102750206-102750228 TGCCCAGAGCAGGTGGGGGCAGG + Intergenic
1122635650 14:103128475-103128497 GGCCCAGGGCGGGGGAGTCCAGG + Intronic
1122688662 14:103521609-103521631 GGCCCAGGGAGGGCGGGTCCTGG - Intronic
1122691667 14:103534683-103534705 TGCCCAGGTCGGGCGGTGGCAGG - Exonic
1122740818 14:103870627-103870649 TGCCCAGGGAGGATGGTACCAGG - Intergenic
1122794640 14:104200093-104200115 TTCCCAGGGCTGGTGGGGCTGGG + Intergenic
1122879038 14:104681830-104681852 CGTCCAGGCCGGGTGTGGCCAGG - Intergenic
1122901718 14:104784788-104784810 TGCCCATGGCGCGTGGGTCCTGG - Intronic
1122956226 14:105072778-105072800 TGCCCTGGGCAGCTGGGGTCGGG + Intergenic
1122985489 14:105209766-105209788 TGCTCAGGACGGGTGGGCGCCGG + Exonic
1123041976 14:105493995-105494017 TGCCCAGGGTGGGAGGGGCCTGG + Intronic
1202845609 14_GL000009v2_random:170790-170812 TGCCCTGGGGGGGTGGGGAATGG + Intergenic
1202915007 14_GL000194v1_random:161058-161080 TGCCCTGGGCGGGTGGGGAATGG + Intergenic
1123706818 15:22956650-22956672 TGGCCAGGAAGGGTGGGGGCTGG + Intronic
1124362016 15:29044592-29044614 AGCCCAGGGGGGGTGTGGCCAGG - Intronic
1124493785 15:30174174-30174196 TGCAGAGGGAGGGTGGGGGCTGG - Intergenic
1124749783 15:32364475-32364497 TGCAGAGGGAGGGTGGGGGCTGG + Intergenic
1125598000 15:40899758-40899780 TACCCAGAGGGGGTAGGGCCTGG + Exonic
1125716385 15:41822134-41822156 GGGCCATGGGGGGTGGGGCCTGG + Intronic
1125774627 15:42201022-42201044 TGCCCAGGGCTGGTGGGCTTGGG + Intronic
1127207227 15:56733424-56733446 AGCGCAGGGCGGGCGGGGGCGGG + Intronic
1127267900 15:57376303-57376325 AGCCGAGGGCGGGTGGTGCGGGG + Intronic
1127480337 15:59372055-59372077 TGCCCGGGGCGGGGCGGGCACGG + Intronic
1127776829 15:62270377-62270399 TGACCAGTGAGGGTGGGGACTGG + Intergenic
1128280063 15:66387140-66387162 AGTCCCGGGCGGGTGGGGCGGGG + Exonic
1128566820 15:68706206-68706228 TGCCCAGTGTGTGTGGGGTCGGG - Intronic
1128791878 15:70440008-70440030 GGTCCAGGGCGGGTGGGGTCAGG + Intergenic
1129721822 15:77881735-77881757 TGCCCAGGACGGGTGGGCAGGGG + Intergenic
1129832340 15:78679180-78679202 AGCACAGGGTGGGTGGGACCTGG + Intronic
1130111761 15:80971219-80971241 TGACCAGGTAGGGTGAGGCCAGG - Intronic
1130564225 15:84980971-84980993 GGTCCCGGGTGGGTGGGGCCTGG - Intronic
1131440368 15:92455026-92455048 TGGCCAGGGCCAGAGGGGCCAGG + Intronic
1132163673 15:99565438-99565460 AGCCCAGGCCGGGAGCGGCCCGG - Intronic
1132574226 16:657252-657274 TCCTCAGGGCGGGGGAGGCCTGG + Intronic
1132580715 16:683533-683555 TGCCCAGGGAGGTGGGGTCCTGG + Exonic
1132591549 16:728399-728421 AGAACAGGGCGGGTGGGTCCGGG - Exonic
1132624703 16:886550-886572 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624720 16:886584-886606 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624737 16:886618-886640 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624754 16:886652-886674 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624771 16:886686-886708 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624788 16:886720-886742 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624805 16:886754-886776 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624822 16:886788-886810 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624839 16:886822-886844 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132624856 16:886856-886878 GGCCTAGGGTGGGAGGGGCCTGG - Intronic
1132737640 16:1394813-1394835 GGCCATGGGGGGGTGGGGCCAGG - Intronic
1132828479 16:1916519-1916541 TGCCCAGGGCGGGCCTGGACTGG + Intronic
1133201017 16:4204490-4204512 TGCCCAGGGCTGGGAGAGCCCGG - Intronic
1133211208 16:4264288-4264310 TGGGCAGGCTGGGTGGGGCCAGG - Intronic
1133241226 16:4415858-4415880 TGCCACGGCTGGGTGGGGCCTGG - Intronic
1133430988 16:5736535-5736557 TGCCTGGGCCGAGTGGGGCCCGG + Intergenic
1134021495 16:10924206-10924228 TCCCCAGGGTGGCAGGGGCCTGG - Exonic
1134065255 16:11224329-11224351 TCCCCTGGGCGGGAGGGGCTGGG + Intergenic
1134074708 16:11282457-11282479 TGACCAGGGCGGGTGGAGCAGGG + Intronic
1134667661 16:16030820-16030842 TGCCTGGTGCGGGTAGGGCCCGG + Intronic
1135003850 16:18801312-18801334 TGCCCAGGGAGAGAAGGGCCGGG + Intronic
1136054850 16:27680693-27680715 TGCAGAGGGAGGGTGGGGCGGGG + Intronic
1136690466 16:32024896-32024918 TCCCCCGAGCGGGTGGGGCAGGG + Intergenic
1138347845 16:56330965-56330987 TGGCCAGGGCCGGAAGGGCCTGG + Intronic
1139534232 16:67562042-67562064 TTCGGAGGGCGGGTCGGGCCTGG + Intergenic
1139960571 16:70715143-70715165 TGCCCAGAGGGTGTGGGGACTGG + Intronic
1140467477 16:75194106-75194128 AGGCCATGGCGTGTGGGGCCTGG + Intergenic
1141083764 16:81076978-81077000 TCCCCAGAGCGGGCGGGGTCTGG - Intronic
1141289068 16:82700962-82700984 TGCCCGGGGCGGGGGGGGGGGGG - Intronic
1141456368 16:84145054-84145076 CGCCCAGGGCGCGGGGGGCGCGG + Intronic
1141834623 16:86530511-86530533 TGCCCACTGCCGGTGGGGCAGGG + Exonic
1142070024 16:88086909-88086931 AGCGTGGGGCGGGTGGGGCCCGG - Intronic
1142124524 16:88403565-88403587 AGGCCAGGGAGGGTGGGACCAGG + Intergenic
1142161956 16:88562259-88562281 TAACCAGCGCTGGTGGGGCCCGG + Intergenic
1142202937 16:88769788-88769810 GGGCCAGGGTGGGCGGGGCCAGG + Intronic
1142215225 16:88826560-88826582 TGCCCAGGGCAGGAGGAGGCAGG - Intronic
1142281940 16:89153430-89153452 TGACACGGGTGGGTGGGGCCAGG - Intronic
1142523239 17:519585-519607 TGCACAGGGAGGATGGGGCAGGG - Intronic
1142672381 17:1493049-1493071 AGACCAGGGCTGCTGGGGCCTGG + Intergenic
1142805161 17:2367597-2367619 GGCCCAGGGCAGGTGGCTCCAGG + Intronic
1142850093 17:2700645-2700667 TGCCCAGCGAGGGCAGGGCCAGG + Intronic
1143099765 17:4498754-4498776 TGCCCTGGGGGTGGGGGGCCCGG - Intergenic
1143101397 17:4506587-4506609 TGCCAAGAGTGGGCGGGGCCGGG - Intronic
1143174713 17:4949376-4949398 TGCCTGGGGCGGGCGGGGCTGGG - Intronic
1143323181 17:6081030-6081052 GGCCCAGGGCGGGCGGTCCCTGG - Exonic
1144509549 17:15864175-15864197 TGCCCAGGGCTGGTGGAAGCTGG - Intergenic
1144782138 17:17813673-17813695 TGCCCTGGGCTGCTGGGGCCGGG + Exonic
1144949395 17:18985786-18985808 TGAGCAGGGCAGGCGGGGCCAGG + Intronic
1145173659 17:20681815-20681837 TGCCCAGGGCTGGTGGAAGCTGG - Intergenic
1145866971 17:28247796-28247818 TGCCCAGGGCACATGGGCCCAGG - Intergenic
1147155734 17:38543753-38543775 TGCCCAGTGGGGCAGGGGCCCGG + Intronic
1147182240 17:38693689-38693711 TGCCCAGGACAGGTGGTTCCTGG + Intergenic
1147805366 17:43127035-43127057 TGTGCAGGGCGGCTGGGGCCCGG - Intergenic
1147845085 17:43399252-43399274 TGCGGAGGGCGGGTGGGAGCCGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148896829 17:50843766-50843788 TGCCGAGGGTGGGAGGGGGCAGG - Intergenic
1149431306 17:56596866-56596888 GGGACAGGGCGGGCGGGGCCGGG - Intergenic
1149562785 17:57620716-57620738 GGCCCAGGGCTGATGAGGCCTGG - Intronic
1149563131 17:57623669-57623691 TGGCCAGTGTGGGAGGGGCCAGG + Intronic
1149578384 17:57729811-57729833 TGCTCAGGGCAGGTGAGCCCTGG + Intergenic
1151193478 17:72415514-72415536 TGGCCAGGCCATGTGGGGCCAGG - Intergenic
1151758148 17:76086425-76086447 CACCCAGGGTGGGTGGGGGCAGG - Intronic
1152013645 17:77735739-77735761 CGCCCAGGGCAGGCTGGGCCTGG - Intergenic
1152108023 17:78342034-78342056 AGCCCGAGGCGGGTGGAGCCGGG + Intergenic
1152112807 17:78366439-78366461 TGCCCAGGACGGGGAGAGCCCGG + Intergenic
1152228605 17:79103792-79103814 TGTTCAGTGGGGGTGGGGCCCGG + Intronic
1152299393 17:79486237-79486259 GGACCAGGGTGGGCGGGGCCTGG + Intronic
1152389131 17:79992403-79992425 AGCCTGGGGCCGGTGGGGCCAGG + Intronic
1152566581 17:81103097-81103119 TGCCCAGTGGGGGTCAGGCCTGG - Intronic
1152569743 17:81116439-81116461 TGCCCGAGGCAGGAGGGGCCTGG - Exonic
1152587074 17:81193894-81193916 GGCCCCAGGCCGGTGGGGCCAGG - Intronic
1152612703 17:81323435-81323457 TTCCCAGGGCAGGTGGGGAGGGG - Intronic
1152697594 17:81804590-81804612 TCCCCAGGGCGGCGGGGCCCGGG - Intronic
1152749699 17:82056998-82057020 GGCGCACGGCGTGTGGGGCCTGG + Intronic
1152755579 17:82085679-82085701 TGCCCAGGGCGCTGGGGGCAGGG + Exonic
1152773773 17:82187518-82187540 TGGCCGGGGCTGGTGGGGCTCGG + Intronic
1152886161 17:82851606-82851628 TGCACAGGGCGGGTGGGAAGAGG + Intronic
1153841607 18:9012959-9012981 TCCCCAGTGGAGGTGGGGCCTGG - Intergenic
1154316589 18:13309176-13309198 TGTGCAGGGCAAGTGGGGCCGGG - Intronic
1154475224 18:14748443-14748465 TGGCAAGGGCGTGCGGGGCCCGG + Exonic
1155507929 18:26549532-26549554 CGCCCTGGGCGGGTGGGGAAGGG - Intronic
1155514022 18:26605948-26605970 TGCCCAAGGTGGTTGGGGCATGG + Intronic
1157562505 18:48658855-48658877 AGCCCAGGGCAAGTGGGCCCTGG + Intronic
1158118576 18:54024174-54024196 TGGCCAGGGGAGGTGGGGACGGG + Intergenic
1159021233 18:63144873-63144895 TGCCCAGGGCGGCGGGGGCGGGG - Intronic
1159556871 18:69955110-69955132 TGGCCTGGGTGGGTGGGGACGGG + Intronic
1160486973 18:79302275-79302297 TCCCCGGGGAGGGTGGGGGCAGG - Intronic
1160702979 19:517449-517471 TGGCCAGGCTGGGTGGGGGCTGG + Intronic
1160786076 19:900752-900774 GGCCTGGGGTGGGTGGGGCCGGG - Intronic
1160973326 19:1780083-1780105 TGCCCAGGGTGGTGGGGGACGGG + Exonic
1161031498 19:2059837-2059859 TGGGCAGGGCAGGTGTGGCCTGG + Intergenic
1161087000 19:2339973-2339995 GGCCCCGGGCGGGTGGGCCGCGG + Intronic
1161161669 19:2765147-2765169 TGCCCAGGGCAGGGGCGGCCGGG - Intronic
1161210443 19:3062653-3062675 TGCCCGGGGCGGGGGCGGGCCGG - Intronic
1161217404 19:3101310-3101332 TCCCCAGGGACTGTGGGGCCAGG + Intronic
1161248388 19:3267590-3267612 TGGCCAGTGAGGGAGGGGCCAGG + Intronic
1161250336 19:3276527-3276549 TGGCCAGGTGGGGCGGGGCCAGG + Intronic
1161428703 19:4218185-4218207 TGGCCAATGGGGGTGGGGCCCGG - Intronic
1161485870 19:4535315-4535337 TGCCCAGGGGGCGTGGCTCCAGG + Intronic
1161486485 19:4538554-4538576 TGTCCAGGGTGGCTGAGGCCTGG + Exonic
1161581945 19:5085934-5085956 GGCCCAGGTCAGGTGGGGCTCGG + Intronic
1162109132 19:8390700-8390722 AGCCTAGAGGGGGTGGGGCCCGG + Intronic
1162182890 19:8882795-8882817 AGCCCAGGGCCTGTGGGGTCAGG + Exonic
1162401868 19:10451317-10451339 TCCCCAGGGCTGGAGGAGCCTGG + Intronic
1162450787 19:10753296-10753318 GACCCGGGGCGGCTGGGGCCTGG - Intronic
1162573820 19:11487245-11487267 TGGCCAGGGGTGGTTGGGCCTGG - Intronic
1162907939 19:13834385-13834407 TGCACAGAGCAGGTGGGGCAGGG + Intergenic
1162932167 19:13962661-13962683 TGGCGGGGGCGGGTGGGGCGGGG + Exonic
1163019220 19:14473720-14473742 TCCCCCGGGCGGCTGGCGCCAGG - Exonic
1163102644 19:15107553-15107575 CTCCCAGGCCGGGTGGGGCTCGG - Intronic
1164544056 19:29144530-29144552 GGCCCAGGTCAGGTGTGGCCTGG - Intergenic
1164628669 19:29746661-29746683 TTCCCAGGGCCAGTGAGGCCAGG + Intergenic
1165045456 19:33101278-33101300 TGTCCAGGGCGGTGTGGGCCGGG + Intronic
1165065483 19:33225854-33225876 GGCCCCGGGCGGCGGGGGCCCGG + Intergenic
1165094468 19:33402770-33402792 TGTCCAGGACGGGAGGGGCCTGG + Intronic
1165227848 19:34366738-34366760 TGGCCAGTGTGGGTGGGACCAGG + Intronic
1165496083 19:36152486-36152508 TGCGCGCAGCGGGTGGGGCCTGG - Exonic
1165873747 19:38991351-38991373 AGCCCAGGGCTGGTGAGGCAGGG - Intronic
1166106471 19:40600382-40600404 TGACCCGCGGGGGTGGGGCCGGG + Intronic
1166111577 19:40626379-40626401 TGACCAGGGGGTCTGGGGCCAGG - Intronic
1166118970 19:40673598-40673620 TGCCCAGGCTGGGCAGGGCCAGG + Exonic
1166137029 19:40783846-40783868 TGCCCGGGGTGGGTGGGGTAGGG + Intronic
1166139165 19:40796678-40796700 TTCCCTGGCCTGGTGGGGCCTGG + Exonic
1166293997 19:41879988-41880010 AGACCAGGGAAGGTGGGGCCTGG + Intronic
1166295693 19:41888198-41888220 AGGCCAGGCCGGGAGGGGCCTGG - Exonic
1166524963 19:43504904-43504926 GGGCCGGGGCCGGTGGGGCCGGG - Exonic
1166723686 19:45012292-45012314 GGCCCCGGGCGGGTGGGACTGGG + Intronic
1166843473 19:45712641-45712663 TGCCCAGTGGGGGCGGGGGCAGG - Exonic
1166948379 19:46411263-46411285 TCCCCAGGGCAGGAGAGGCCAGG - Exonic
1166961913 19:46502171-46502193 TGCCCAGGGCGGGACTGGGCAGG - Intronic
1167597370 19:50434877-50434899 TGGCCTGGGCGGATGGGGCAGGG + Intronic
1167765245 19:51478472-51478494 TGACCAGCAGGGGTGGGGCCTGG - Intergenic
1168310369 19:55456906-55456928 TGACCAGGGCGGATGGTGACTGG - Intronic
925690207 2:6514615-6514637 TCCCCAGTGTTGGTGGGGCCTGG - Intergenic
925868263 2:8247550-8247572 TGCCCAGGGCAGGGTGGGCTGGG - Intergenic
925972237 2:9113661-9113683 TGCCCTGAGGAGGTGGGGCCCGG - Intergenic
926035148 2:9630654-9630676 TGCCCAGCGGGGGAGGGGGCGGG - Intronic
926165432 2:10520136-10520158 TGCCCAGGGCGGCTCTGACCAGG - Intergenic
927209141 2:20627997-20628019 TCCCCAAGGCGGGAGGGGCAGGG + Intronic
928087704 2:28356198-28356220 TGCTCTGGGTGGGAGGGGCCTGG - Intergenic
928089702 2:28366593-28366615 TGGCCAGGTCGGGTGTGACCAGG + Intergenic
929992058 2:46798514-46798536 TGGCCAGGTCAGTTGGGGCCAGG + Intergenic
932467899 2:71935130-71935152 TGACCTGGGCAGGTGTGGCCAGG + Intergenic
934735878 2:96689529-96689551 TGCCCAGAGCAGGTGGGGATGGG + Intergenic
936049212 2:109210616-109210638 TGCCTGGGCCTGGTGGGGCCTGG + Intronic
937907379 2:127058863-127058885 TGCCCAGTGGGGGTTGGGCCTGG - Intronic
938066002 2:128282443-128282465 TGCCGCGGGCCGGTGGGGGCTGG - Intronic
942091097 2:172492105-172492127 TGCCCAGGAAGGGAGAGGCCAGG - Intronic
943578843 2:189661353-189661375 TGCGCAGGCCGGGTCTGGCCTGG - Intergenic
945140959 2:206685699-206685721 TGCCCAGGGTGGGTGGGTGAAGG - Intronic
946177353 2:217929695-217929717 TGGCCGGGGCGGGTGGGGGGTGG - Intronic
946317180 2:218924017-218924039 TGCACAGAGCTGCTGGGGCCTGG + Intergenic
947544262 2:231000307-231000329 TGCCCTGGGAGGCTGGGGCGGGG - Intronic
947712471 2:232323926-232323948 AGGCCAGGCCGGGTGGGGCTGGG - Intronic
947731430 2:232433606-232433628 AGGCCAGGCCGGGTGGGGCTGGG - Intergenic
947749267 2:232524238-232524260 TGTGCCGCGCGGGTGGGGCCGGG - Intronic
947750146 2:232527762-232527784 CGCCCAGAGCCGGTGGGGTCGGG + Intronic
947826216 2:233107679-233107701 TGTCCAGGGCTGGGGGGCCCTGG - Intronic
947860476 2:233354436-233354458 GGCCGAGGGCGGGCCGGGCCGGG - Intergenic
948040917 2:234900841-234900863 TGCCCAGGGCGAGGGTGGGCAGG - Intergenic
948492227 2:238320849-238320871 GGCCCGGGCCGGGTGGCGCCGGG + Intronic
948567774 2:238897489-238897511 TGGCCTGGGTTGGTGGGGCCTGG - Intronic
948580859 2:238986464-238986486 TGCGCAGGGCAGGTGAGGCCAGG - Intergenic
948992498 2:241561976-241561998 TGCCCAGAGCAGGAGGGACCAGG - Intronic
949082383 2:242113213-242113235 TGCCCATAGGTGGTGGGGCCAGG - Intergenic
1168958042 20:1848513-1848535 TTCCCCTGGCAGGTGGGGCCAGG - Intergenic
1169118269 20:3081225-3081247 TGCCCAGGGCTGCTGAGGCTGGG + Intergenic
1169824008 20:9746204-9746226 TGTCCAGGGTGTGTGGGGCAGGG - Intronic
1171216477 20:23356265-23356287 TGCCCATTGCGGGTCTGGCCCGG - Intergenic
1171462640 20:25307505-25307527 GGCACAGGTTGGGTGGGGCCTGG + Intronic
1172083317 20:32358924-32358946 TGCCCACCGCGGGAGGGGGCGGG + Intronic
1172282034 20:33714699-33714721 TGACCAGCGCGTGAGGGGCCCGG + Exonic
1172479334 20:35261694-35261716 CGGGCAGGGCAGGTGGGGCCCGG - Intronic
1172568875 20:35953784-35953806 TGCCCGAGGCGGCTCGGGCCCGG - Exonic
1172809999 20:37640617-37640639 TGGACAGGGCGGGAGAGGCCAGG + Intergenic
1173079191 20:39849882-39849904 TGCCCAGGGCCGGAGGCTCCGGG - Intergenic
1173122682 20:40308098-40308120 TGCCCAGGCCCGGCGAGGCCTGG - Intergenic
1173495499 20:43514808-43514830 GGCCCTGTGCGGGTGGGGCGAGG + Intronic
1173588796 20:44208115-44208137 TGCCCAAGAGGGGTGGGGGCGGG - Intronic
1173991768 20:47309193-47309215 TGCCAAGGGAGGGTGGGCTCTGG + Intronic
1174555650 20:51393683-51393705 TGCCCGGGGCAGGTGGGGTCGGG + Intronic
1175220122 20:57411965-57411987 TGCCCAAGTCCTGTGGGGCCTGG + Intergenic
1175926589 20:62474339-62474361 TGTCCAGGGAGGCGGGGGCCAGG + Intronic
1176014892 20:62926067-62926089 TGGCCTGGGCGAGTGCGGCCCGG - Intronic
1176033266 20:63024047-63024069 GGGCCAGGGAGGGTGGGGGCCGG - Intergenic
1176162274 20:63653824-63653846 TCCCCAGGGCAGGCGGGGCAGGG + Intergenic
1176173043 20:63704844-63704866 TGCCCTGGGCAGGTGTGACCTGG - Intronic
1176634358 21:9175703-9175725 TGCCCTGGGGGGGTGGGGAATGG + Intergenic
1177310066 21:19378992-19379014 TGGCCAGGGCAGTTGGGGTCGGG + Intergenic
1178104120 21:29299237-29299259 TACCCGGGGCGGGCGGGGGCTGG + Intronic
1178582319 21:33847320-33847342 AGCGCAGGGCTGGTGGGGACTGG - Intronic
1179726680 21:43344883-43344905 TGGCAAGGTCGGGTGGGGGCTGG - Intergenic
1179786467 21:43733261-43733283 TTTCCAGGGCGGGGGGGGCGGGG - Intronic
1179882004 21:44296800-44296822 TTCCCAGGGAGGGTGGGGCGTGG + Intronic
1179998979 21:44986645-44986667 TGCCCAGGGCGGGGAGGCCCAGG - Intergenic
1180079979 21:45482182-45482204 TGACCTGGGCGGCTGGGGCTTGG + Intronic
1180089215 21:45525199-45525221 TGCCCTTGGCGGGTGGGACAAGG - Intronic
1180092203 21:45538885-45538907 TGCCCTGGCCGTGTGGGGCGGGG - Intronic
1180597719 22:16989708-16989730 TGCCCAGGGAGGGTGCAGCCTGG + Intronic
1181115856 22:20632201-20632223 GGCCCAAGCCTGGTGGGGCCTGG - Intergenic
1181121556 22:20670844-20670866 AGCCCGGGCCTGGTGGGGCCGGG - Intergenic
1181335376 22:22124758-22124780 TGCCCAGGGCGGGGCGGGTGGGG + Intergenic
1181637562 22:24181422-24181444 AGTGCAGGGCGGGCGGGGCCAGG + Exonic
1181658111 22:24318106-24318128 TTCCCAGACGGGGTGGGGCCGGG + Intronic
1181760054 22:25052071-25052093 GGCCCATGGCGGGAAGGGCCTGG - Intronic
1182098107 22:27639381-27639403 GGCCCAGGCAGGATGGGGCCTGG - Intergenic
1182160821 22:28119631-28119653 TGGCAAGTGTGGGTGGGGCCAGG + Intronic
1182421137 22:30249084-30249106 GGCCCAGAGCAGGTGGTGCCTGG - Intergenic
1182497310 22:30718656-30718678 TGCCCAGGGCCTGTGGCCCCAGG - Intronic
1183363628 22:37395819-37395841 GGCCCAGGGTGGGAGGGGCAGGG + Intronic
1183421394 22:37713602-37713624 GGCCCAGGGCAGCTGGGGTCTGG + Intronic
1183502354 22:38188562-38188584 TGCCCTGGAAGGTTGGGGCCAGG + Intronic
1183591089 22:38779642-38779664 GGCGCAGGGCAGGTGGGGGCAGG + Intronic
1183697748 22:39432759-39432781 TGCCCTAAGCGTGTGGGGCCGGG + Intronic
1184131634 22:42519890-42519912 GGGCCATGGCGGGCGGGGCCGGG - Intergenic
1184184690 22:42856946-42856968 GGGCCGGGGCGGGCGGGGCCGGG - Intronic
1184232853 22:43167902-43167924 TGCCCAGGGCCGGTGTGGGGAGG + Exonic
1184269582 22:43371388-43371410 TGCCCAGGGAAGCTGGAGCCTGG + Intergenic
1184286130 22:43472729-43472751 TGGCCAGGGAGGGTGGGCCAGGG - Intronic
1184395950 22:44240666-44240688 TGTCCAGGGTGGTTGGGGCACGG + Intergenic
1184503088 22:44885690-44885712 TGTCCGGGGCAGGTGTGGCCAGG - Intronic
1184517261 22:44970405-44970427 TGCCAGGGGAGGGTGGGACCTGG + Intronic
1184663455 22:45976061-45976083 GGCCCCGGGCGGGCGGGGCACGG + Intronic
1184693056 22:46126064-46126086 ATCCCAGGGCGGGTGGGGCCTGG - Intergenic
1184831881 22:46993937-46993959 CGCCCTCGGGGGGTGGGGCCGGG + Intronic
1185008200 22:48298189-48298211 AGGCCAGGGAGGGTGGGGCAGGG + Intergenic
1185089531 22:48757898-48757920 TGCCCAGTGGGGCTGGGGTCAGG - Intronic
949189576 3:1235856-1235878 TGCTGGGGGCGGGTGGGGCATGG + Intronic
949563347 3:5222780-5222802 TCCCCAGGGCTGGAGGGGCGAGG + Intergenic
950366039 3:12484766-12484788 TGTTCAGGGCTGGTGGGGCTGGG + Exonic
950424408 3:12917010-12917032 TGCCCTGAGCAGGTGGGGCAGGG + Intronic
950683918 3:14603027-14603049 TGCCCGGCGGGGGCGGGGCCGGG - Intergenic
950704716 3:14772712-14772734 AGCCCAGGCCCGGTTGGGCCAGG - Intronic
951332923 3:21387337-21387359 AGCCCACGGCGGGTGGGGGGAGG + Intergenic
951558758 3:23945682-23945704 TCCCCATGGCCGGTGGGGCGGGG + Intronic
953032087 3:39185856-39185878 GGGCCAGGGCGGGAGGAGCCTGG - Exonic
953711254 3:45273039-45273061 AGCCCAGGGCTGGAGTGGCCTGG - Intergenic
954439875 3:50516109-50516131 TGCGCAGGGCAGGCGGGGCCCGG - Intergenic
954710528 3:52503140-52503162 AGCTCAGGGCGGGCGGGGGCTGG + Intronic
954738909 3:52730865-52730887 TGCCAGGGGCTGGTGGGGGCAGG + Intronic
954800280 3:53183272-53183294 TCCCCAGGGAGGGTGGGGAGAGG - Intronic
954902539 3:54032117-54032139 GGCCCAGGGGGGCTGGGGCAAGG + Intergenic
955557509 3:60153804-60153826 TGGCCAGGGCTGGAAGGGCCTGG - Intronic
958732228 3:97972155-97972177 GGGGCAGGGTGGGTGGGGCCCGG - Exonic
961042799 3:123689178-123689200 TGGCCAGGGTGGCTGGGGACAGG + Intronic
961505787 3:127369859-127369881 TGCCCAGTGAGGGTGGGGCTGGG - Intergenic
961522592 3:127475582-127475604 AGCCCATGGTGGGTGGGGCTTGG - Intergenic
961609602 3:128126120-128126142 TGGCCAGTACGGGTGGGGACAGG + Intronic
961688358 3:128650817-128650839 GCGCCAGGGCGGGTAGGGCCCGG + Exonic
961780388 3:129317204-129317226 CCCCCGGGGAGGGTGGGGCCCGG - Intergenic
961827573 3:129606866-129606888 TCCCGGGGGCGGGCGGGGCCGGG - Intergenic
962391885 3:134978973-134978995 TCCTCATGGAGGGTGGGGCCAGG + Intronic
962498479 3:135965940-135965962 AGGCCGGGGCGGGCGGGGCCGGG + Intronic
962576012 3:136755836-136755858 TGTCCAGGGAGGGTGGGGGTGGG - Intergenic
963572486 3:147015585-147015607 TGCACAGGGCAGCTGGGCCCTGG - Intergenic
964279894 3:155052618-155052640 TGCACAGGGCAGGGGGGCCCTGG + Intronic
965446502 3:168780385-168780407 AGCCCAGGGAGGGTGGGGGGTGG - Intergenic
966918594 3:184598066-184598088 TGCCTGGGGCGGTTGGGGTCAGG + Intronic
968150553 3:196334791-196334813 TGCCCTGGGAGGGTGGGGGTAGG + Intronic
968150799 3:196335456-196335478 TGCCCTGGGAGGGTGGGGGTAGG + Intronic
968150816 3:196335491-196335513 TGCCCTGGGAGGGTGGGGGTAGG + Intronic
968512613 4:1002239-1002261 TGTCCAGGGCAGCTGGGACCGGG - Intronic
968514305 4:1009879-1009901 GGCCCCTGGCGGGCGGGGCCGGG - Intergenic
968600766 4:1508336-1508358 TCCCCAGGGTGGCTAGGGCCGGG + Intergenic
968626821 4:1629537-1629559 GGCCCAGAGCTGGTGGAGCCTGG - Intronic
968652955 4:1767302-1767324 TTCCCAGGCCGGGAGGGGCGCGG - Intergenic
968698026 4:2042194-2042216 GGCCCGGGGTGGGTGGGTCCAGG + Intronic
968872411 4:3248594-3248616 GGCCCAGGGCGCCTGGGGGCTGG + Exonic
968872566 4:3249218-3249240 CGCCCATGGTGCGTGGGGCCGGG + Exonic
968876363 4:3269798-3269820 AGCTCAGGGCGGGTGGGGTCTGG + Intronic
968958347 4:3730415-3730437 TGCCCAGGGCGGGTGCTGGTGGG + Intergenic
969271866 4:6108442-6108464 TGCCCTGGGGGTGTGGGGGCTGG + Intronic
969418210 4:7074769-7074791 AGGCCAGGACGGGTGTGGCCGGG + Intergenic
969630025 4:8330567-8330589 GGCCCAGGCCGTGTGGGGACGGG + Intergenic
969712674 4:8853025-8853047 AGCCCAGGGCTAGTGTGGCCAGG - Intronic
969788129 4:9474293-9474315 TCCCCAGGGCGGGGGGCGCCCGG - Intergenic
972418690 4:38867550-38867572 AGCCCAGGGCGGGTGGGTCTCGG - Intergenic
972733201 4:41815220-41815242 TGCTCAGGGGGAGTGGGGACGGG - Intergenic
975710810 4:77158051-77158073 CGCCCCGGGCGGGCGGGGCTCGG + Intronic
978543682 4:109846905-109846927 TTCCTAGGGTGGGTGGTGCCTGG - Intergenic
984815279 4:183830573-183830595 TGCCCAGGGCTGGTCTGGCCTGG + Intergenic
985386346 4:189452182-189452204 TGCACAGGGCAGCAGGGGCCTGG - Intergenic
985520423 5:371622-371644 AGCCCAGGACAGGTGGGCCCAGG - Intronic
985554010 5:547273-547295 TGTCCAGGTAGGGTGGGGCTGGG + Intergenic
985579720 5:690263-690285 TGCCCAGGAGGGTTGTGGCCGGG - Intronic
985594566 5:782322-782344 TGCCCAGGAGGGTTGTGGCCGGG - Intergenic
985635737 5:1034896-1034918 TGGCCAGGGTGAGTGAGGCCTGG + Exonic
985727455 5:1523682-1523704 TGCCCAGGGCGCGCGGCCCCGGG - Intronic
985766133 5:1780426-1780448 TGCCCAGGGAGGGTGGGAGGAGG + Intergenic
985783613 5:1883062-1883084 GGCTCAGGCCGGGAGGGGCCAGG + Intronic
985817554 5:2137818-2137840 TCCTCAGGGCAGGCGGGGCCTGG + Intergenic
985823425 5:2176211-2176233 TCCCCAGGGCTGGAGGGGCAGGG + Intergenic
985939086 5:3120037-3120059 TGCCCAGGGCCAGCAGGGCCTGG - Intergenic
985994805 5:3591984-3592006 TGCCCCAGGAGGGTGGGGCAGGG + Intergenic
987054869 5:14181814-14181836 AGCCCAGGCCGGGAGGGGCGTGG - Intronic
987154262 5:15072053-15072075 TGCCCAGTGTGGGTGGGGTATGG - Intergenic
987169574 5:15240340-15240362 TGCACAGAGCAGGTGGGACCTGG - Intergenic
990021104 5:51128457-51128479 TGCACAGAGCAGGGGGGGCCTGG - Intergenic
990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG + Intergenic
990512162 5:56498916-56498938 TGCCCAGGGCCAGTGGTGCCGGG + Intergenic
990532517 5:56688327-56688349 TGCCCTTGGAGTGTGGGGCCTGG - Intergenic
990949322 5:61280898-61280920 TGCCTGGGGAGAGTGGGGCCAGG + Intergenic
991003555 5:61806327-61806349 TGGCCAGGGTGGCTGGGGACAGG + Intergenic
991584486 5:68187995-68188017 TGCCCAGGCCCGGCGAGGCCGGG + Intergenic
993038853 5:82788967-82788989 TGCCAAGGGCTGGTGGGGGAAGG + Intergenic
999960737 5:156753241-156753263 TGGCCAGGAAGGGTGGGGGCCGG - Intronic
1000971037 5:167714844-167714866 TCCCCAGGATTGGTGGGGCCTGG + Intronic
1001265260 5:170269451-170269473 TGGCCAGTGCGGGTGGAGCAGGG - Intronic
1001972955 5:175971492-175971514 AGGCCAAGGCGGGTGAGGCCAGG - Intronic
1001973661 5:175978937-175978959 TGCCCAAGGTGGTTGGGGCATGG - Intronic
1002000434 5:176193811-176193833 TGCTGAGGACGGGTGGGGCAGGG - Intergenic
1002134321 5:177098573-177098595 TGGCCAGGGCGGGGCGGGCATGG - Intergenic
1002179426 5:177423047-177423069 TGCTTAAGGCTGGTGGGGCCTGG - Intronic
1002243771 5:177864842-177864864 TGCCCAAGGTGGTTGGGGCATGG + Intergenic
1002244483 5:177872297-177872319 AGGCCAAGGCGGGTGAGGCCAGG + Intergenic
1002382169 5:178838910-178838932 GGCCAAGGCTGGGTGGGGCCTGG + Intergenic
1002605577 5:180381060-180381082 GGCCCAGGGTGGGTGGAGGCTGG - Intergenic
1002648554 5:180674355-180674377 GGCCAAGGCTGGGTGGGGCCTGG - Intergenic
1003046508 6:2737968-2737990 TGCCGGGGGCGGGTGGGGGGGGG + Intronic
1003290585 6:4776035-4776057 GGCCCAGGGCAGGCGGGACCTGG - Intronic
1003953321 6:11139749-11139771 TGCCCAGGGGGTGGGAGGCCAGG - Intergenic
1004456863 6:15799405-15799427 TGCCTAGGGAGGTGGGGGCCTGG + Intergenic
1006451935 6:34110424-34110446 TGGCCAGGTCGGGTGGGGGAGGG - Intronic
1006640406 6:35486551-35486573 TGCGGAGGGCGTGTGGAGCCCGG - Exonic
1006742702 6:36320790-36320812 TCAGCCGGGCGGGTGGGGCCAGG + Intronic
1006932820 6:37697782-37697804 GGCCCAGAGCGGGCGGGGCCGGG + Exonic
1006985134 6:38170875-38170897 TGCCCAGGTCGGGCACGGCCCGG - Exonic
1007383509 6:41505106-41505128 TGCCCAGGGCGGCCTTGGCCGGG - Intergenic
1007738726 6:43998201-43998223 TGCCCAGGGCCGGTGGGGCCTGG - Intergenic
1010002093 6:70957676-70957698 TGATCATGGCGGGTGGGGGCGGG + Intergenic
1011449005 6:87473119-87473141 TGCCCAGTGCCTCTGGGGCCTGG + Intronic
1017005540 6:150025924-150025946 TGCCCAGGGCGGGGTGAGCCAGG - Intergenic
1018072113 6:160173986-160174008 TGCTCAGGGAGGGTGAGGTCGGG + Intronic
1019162917 6:170080998-170081020 CGCAGTGGGCGGGTGGGGCCCGG - Intergenic
1019235902 6:170612355-170612377 GGCCCAGGGCTGGAGGGGCCGGG - Intergenic
1019276128 7:176934-176956 TGTTCAGGGTGGGTGGGGCGTGG + Intergenic
1019277547 7:183858-183880 GGCCCGGGGAGGGTGGGGACAGG - Intergenic
1019430812 7:998181-998203 TGCTCAGGGCGGCAGTGGCCAGG + Intronic
1019456581 7:1130704-1130726 GGCCCCGGGCGGGTGGGGGCGGG + Intronic
1019485168 7:1285943-1285965 TGCCCAGCGCTGGAGGGGCAGGG - Intergenic
1020280477 7:6647673-6647695 GGCCCAGGTCAGGTTGGGCCTGG + Intronic
1021804710 7:24343495-24343517 TGCCCTGGGTGGGAGGGGACAGG - Intergenic
1021805357 7:24349491-24349513 TGCCCTGGGTGGGAGGGGACAGG + Intergenic
1022179616 7:27906264-27906286 TGCCTGGGGCATGTGGGGCCAGG - Intronic
1022270068 7:28798360-28798382 TGCCCAGGGTGGGTGTGGGTGGG + Intronic
1023879040 7:44308308-44308330 TGCCCATGGTAGGTGGAGCCAGG + Intronic
1023890505 7:44388757-44388779 AGCCCAGGGCTGGTGGCGCGGGG - Intronic
1023967290 7:44969618-44969640 TGCCCATGCCTCGTGGGGCCTGG - Intronic
1024312124 7:47979301-47979323 GGCCGCGGGAGGGTGGGGCCGGG - Intronic
1024339623 7:48243902-48243924 TGCCCAGAGCAGGTGAGTCCAGG - Intronic
1026086324 7:67266087-67266109 TGCCAAGGGCTGGTGGGGGAGGG - Intergenic
1026690820 7:72548742-72548764 TGCCAAGGGCTGGTGGGGGAGGG + Intergenic
1026825357 7:73578319-73578341 GGCCCGCGGCTGGTGGGGCCCGG - Intronic
1027190275 7:75992407-75992429 TGCCCATGGCGGGTGGGGTAGGG + Intronic
1027266695 7:76498588-76498610 TGCCCAGCCCTGGTGAGGCCGGG - Intronic
1027303697 7:76869322-76869344 TGCCGAAGGCCAGTGGGGCCTGG + Intergenic
1027318075 7:76996705-76996727 TGCCCAGCCCTGGTGAGGCCGGG - Intergenic
1028774060 7:94658183-94658205 GGCCCAGGAGAGGTGGGGCCTGG - Intronic
1029238859 7:99144236-99144258 TGCCTCGGGCGCGCGGGGCCCGG + Intergenic
1029479522 7:100804063-100804085 TGCCCAGGCCCCGTGGGGCAGGG + Intronic
1029508150 7:100975292-100975314 TGCCCTGGAGGGGCGGGGCCAGG + Intronic
1029746472 7:102517924-102517946 TCCCCAGGGCGGGGAGGGGCCGG + Intergenic
1029764409 7:102616903-102616925 TCCCCAGGGCGGGGAGGGGCCGG + Intronic
1029903989 7:104072036-104072058 AGCCCACGGTGGGTGGGGCGGGG - Intergenic
1032344335 7:131105860-131105882 TGCCGTGGGCGGGAGGGGGCCGG - Intergenic
1033275630 7:139969709-139969731 TGCCCAGGTCTGCTGGGGTCGGG + Intronic
1033409330 7:141102936-141102958 TGGCTAAGGCGGGTGGAGCCAGG + Intronic
1033447641 7:141436620-141436642 TGCCCGGAGCTGGTGGGGGCTGG + Intronic
1033779359 7:144650701-144650723 TGCCCATGGCGGGTGGCGGTGGG - Intronic
1034269209 7:149795519-149795541 TGCCTGGGGAGGGAGGGGCCAGG - Intergenic
1034438602 7:151075544-151075566 TCCCCAGGGCTACTGGGGCCAGG + Intronic
1034682545 7:152940048-152940070 GCGCCAGGGCTGGTGGGGCCAGG + Intergenic
1035292998 7:157851596-157851618 TGCCCTTGGCGGGTGTGCCCTGG - Intronic
1035515815 8:231888-231910 GGCCCAGGGCTGGAGGGGCCGGG - Intergenic
1035540305 8:429939-429961 TGCCCATAGGTGGTGGGGCCAGG - Intronic
1035573727 8:690717-690739 TGCCCAGGGGGCCTGGTGCCAGG + Intronic
1035599999 8:891774-891796 AGCCCAGGACGGGGAGGGCCTGG + Intergenic
1035877884 8:3211737-3211759 TGGCCAGTGCGGGCAGGGCCGGG - Intronic
1036658403 8:10692179-10692201 GACACAGGGCGTGTGGGGCCAGG + Intronic
1036766563 8:11553334-11553356 TGCCCTGGGCAGGCAGGGCCTGG - Intronic
1037901521 8:22692038-22692060 TGCCCGAGGAGGCTGGGGCCGGG - Intronic
1038012534 8:23486443-23486465 TGTGCAGGGCGGCTGGGCCCAGG - Intergenic
1038870691 8:31489968-31489990 TCCCCAGGGCTGGCAGGGCCAGG - Intergenic
1039428352 8:37505550-37505572 GGCCCAGGGTGGGTGGAGCAAGG - Intergenic
1039844362 8:41315513-41315535 TGCCAAGTGGGGGTGGGGACTGG + Intergenic
1041095316 8:54343681-54343703 AGCCCAGGAAGGCTGGGGCCAGG - Intergenic
1041279911 8:56198863-56198885 TGCTCATTGTGGGTGGGGCCTGG + Intronic
1041517073 8:58712163-58712185 TGCCTAGGGCTGGTGGGGAGAGG + Intergenic
1045110993 8:98939818-98939840 CGCCCAGGGCGGGACTGGCCCGG - Intronic
1045437040 8:102173824-102173846 TGCCCAGGGCAGCGGGGCCCTGG + Intergenic
1046650593 8:116833029-116833051 TGCACAGGGCGGGTGGAGGGTGG + Intronic
1046671949 8:117065898-117065920 TGACTAGGGCTGGTGGAGCCTGG + Intronic
1047307980 8:123668733-123668755 AGCCCAGGGTGGCTGGTGCCTGG + Intergenic
1047926090 8:129683969-129683991 TGCCCAGAGCAGTTGGGGCCCGG - Intergenic
1048883873 8:138892852-138892874 TGCCCATTGCGGGTGGGGGCTGG + Intronic
1049095812 8:140547457-140547479 GCCCCAGGGCAGGTGAGGCCCGG - Exonic
1049198137 8:141326516-141326538 TCCCCAGGTGGGGTGGGACCGGG + Intergenic
1049223161 8:141437006-141437028 TCCCCATGGCGGGAAGGGCCAGG - Intergenic
1049223176 8:141437043-141437065 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223191 8:141437080-141437102 TCCCCATGGCGGGCAGGGCCAGG - Intergenic
1049223206 8:141437117-141437139 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223221 8:141437154-141437176 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223236 8:141437191-141437213 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223251 8:141437228-141437250 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223266 8:141437265-141437287 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049223280 8:141437302-141437324 TCCCCACGGCGGGCAGGGCCAGG - Intergenic
1049242182 8:141543657-141543679 TGCCCTGGGTGGGTGGGCGCAGG + Intergenic
1049537045 8:143187297-143187319 GCCCCAGGGAGGGTGGAGCCCGG + Intergenic
1049537843 8:143190182-143190204 TGCCCAGGGCGGGGGAGCACAGG + Intergenic
1049572843 8:143377727-143377749 TGCCCTAGGAGGATGGGGCCTGG + Intronic
1049665397 8:143840647-143840669 CTCCCAGAGCGGGAGGGGCCTGG - Intronic
1049681852 8:143922464-143922486 TGCGACGGGCGGGTGGGCCCGGG - Intronic
1049775017 8:144400131-144400153 TGGCTGGGGCGGGGGGGGCCCGG - Intronic
1049800813 8:144516746-144516768 GGCCCAGGGCTGGTCCGGCCTGG + Exonic
1053472953 9:38359839-38359861 TCCCCAGGGCTGGTGGAGGCAGG + Intergenic
1055440941 9:76335296-76335318 TCCCCAGGGCTGGTGGGGGGAGG + Intronic
1056222703 9:84465865-84465887 AGCCTAGGGCTGGTGGGGCGGGG + Intergenic
1056258695 9:84826048-84826070 TGTCCATGGCGGGTGGGGGGTGG - Intronic
1056903147 9:90620016-90620038 TGCCTAGGGAGGGTGGGGTAGGG + Intronic
1057157282 9:92853996-92854018 TGGCAGGGGCGGGTGGGGCTGGG + Intronic
1057592297 9:96383377-96383399 GGGACAGGGCGGGTGGGGACAGG - Intronic
1057627045 9:96686996-96687018 TGCCGAGGGCGGGGCGGGGCGGG - Intergenic
1058149882 9:101452551-101452573 TGCACAGGGCAGGGGGGACCTGG - Intergenic
1059341051 9:113597768-113597790 TTCCCAGGGTGGCTGGGGCTGGG + Intergenic
1060152258 9:121296175-121296197 TGCCCAGGTCAGGTGGTGCTAGG + Intronic
1060214679 9:121731659-121731681 TGCCCAGTGGGGCTGGGGCTGGG + Intronic
1060219702 9:121757934-121757956 TCCCCAGGGCTGGGGGTGCCAGG - Intronic
1060220679 9:121762622-121762644 TGCCCAGGAGGGGTGGACCCAGG - Intronic
1060398816 9:123335493-123335515 GGCAGAGGGCAGGTGGGGCCAGG - Intergenic
1060747883 9:126149656-126149678 TGCCCAGGGGTGCTGTGGCCAGG + Intergenic
1060767360 9:126304799-126304821 TGGCCAGGGTGGGCAGGGCCAGG + Intergenic
1060977227 9:127771663-127771685 TTCCCTGGGTGGGAGGGGCCAGG + Intronic
1061059913 9:128245104-128245126 AGCACAGGGCGGGTGGTGGCGGG + Intronic
1061398580 9:130356301-130356323 TGCCAGGGGTGGGTGGAGCCTGG + Intronic
1061475499 9:130863057-130863079 TGCCCAGGGTACGTGGGGCAAGG + Intronic
1061479111 9:130887828-130887850 TGCCCAGGGCCTCTGCGGCCTGG + Intergenic
1061514133 9:131078894-131078916 GGCCCAGGGCGAGAGGAGCCAGG - Intronic
1061660643 9:132127971-132127993 AGCCGAGGCCGGGTGGGGCGGGG + Intergenic
1061873491 9:133532806-133532828 TGGCCAGGGGAGCTGGGGCCTGG + Intronic
1061899557 9:133666045-133666067 TGGCCAGGGGTGGTGGGGCAGGG - Intronic
1061918461 9:133769384-133769406 TCCCCAGGGCGTGGGGGGACCGG - Intronic
1061922518 9:133789734-133789756 GCTGCAGGGCGGGTGGGGCCGGG + Intronic
1062023735 9:134330959-134330981 TGCCTGGGTCAGGTGGGGCCAGG + Intronic
1062309712 9:135929249-135929271 AGCCCAGGGCTGGCAGGGCCAGG - Intergenic
1062341379 9:136095198-136095220 TGCCCAGGCCGGACCGGGCCGGG - Exonic
1062565088 9:137160809-137160831 AGCCCCGGGGGGGTGGGGGCTGG - Intronic
1203757197 Un_GL000218v1:143344-143366 TGCCCTGGGGGGGTGGGGAATGG + Intergenic
1185662935 X:1741445-1741467 GGCCAAGGGGGGGTGGGGGCGGG + Intergenic
1186998864 X:15154482-15154504 TGCCTAGGGCTGGTGGGGAATGG + Intergenic
1189685476 X:43559780-43559802 TCCCCAGGGGAGGTGGGCCCAGG - Intergenic
1192796264 X:74426049-74426071 TCCCAAGGTTGGGTGGGGCCAGG + Intronic
1193586129 X:83323712-83323734 TTCCAAGGGGGGTTGGGGCCTGG + Intergenic
1193743782 X:85249869-85249891 TGCCTAGGGCTGGTGGGGAGAGG - Intronic
1194733087 X:97479195-97479217 CCCCCAGGGTGGGTGGGGTCGGG - Intronic
1199257131 X:145729778-145729800 TCCCGAGGGCTGGTGGAGCCCGG + Intergenic
1200025328 X:153252911-153252933 TGCCCAGTGGGGGGGGGGCGTGG - Intergenic
1200049722 X:153422356-153422378 TGCTCAGGGATGATGGGGCCTGG - Intergenic
1200117430 X:153775482-153775504 GTCCAGGGGCGGGTGGGGCCAGG + Intronic
1200213289 X:154356409-154356431 TGCGCAGGGCGGGGGAGGCTGGG - Intronic
1201170775 Y:11260964-11260986 TGCCCTGGGAGGGTGGGGAATGG + Intergenic
1202388618 Y:24347992-24348014 GGCCCAGGCTGGGTGGGGGCGGG - Intergenic
1202482169 Y:25322136-25322158 GGCCCAGGCTGGGTGGGGGCGGG + Intergenic