ID: 1075399300

View in Genome Browser
Species Human (GRCh38)
Location 10:122149960-122149982
Sequence GGAGACTGAGCGGGAACCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399300_1075399307 1 Left 1075399300 10:122149960-122149982 CCCCTGGTTCCCGCTCAGTCTCC No data
Right 1075399307 10:122149984-122150006 AAATGTGAGCTGCCGCGGAGTGG No data
1075399300_1075399310 9 Left 1075399300 10:122149960-122149982 CCCCTGGTTCCCGCTCAGTCTCC No data
Right 1075399310 10:122149992-122150014 GCTGCCGCGGAGTGGGTGCTGGG No data
1075399300_1075399309 8 Left 1075399300 10:122149960-122149982 CCCCTGGTTCCCGCTCAGTCTCC No data
Right 1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG No data
1075399300_1075399312 21 Left 1075399300 10:122149960-122149982 CCCCTGGTTCCCGCTCAGTCTCC No data
Right 1075399312 10:122150004-122150026 TGGGTGCTGGGCTGTCCCGCTGG No data
1075399300_1075399305 -4 Left 1075399300 10:122149960-122149982 CCCCTGGTTCCCGCTCAGTCTCC No data
Right 1075399305 10:122149979-122150001 CTCCGAAATGTGAGCTGCCGCGG No data
1075399300_1075399308 2 Left 1075399300 10:122149960-122149982 CCCCTGGTTCCCGCTCAGTCTCC No data
Right 1075399308 10:122149985-122150007 AATGTGAGCTGCCGCGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399300 Original CRISPR GGAGACTGAGCGGGAACCAG GGG (reversed) Intronic