ID: 1075399303

View in Genome Browser
Species Human (GRCh38)
Location 10:122149969-122149991
Sequence TCACATTTCGGAGACTGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399303_1075399312 12 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA No data
Right 1075399312 10:122150004-122150026 TGGGTGCTGGGCTGTCCCGCTGG No data
1075399303_1075399310 0 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA No data
Right 1075399310 10:122149992-122150014 GCTGCCGCGGAGTGGGTGCTGGG No data
1075399303_1075399309 -1 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA No data
Right 1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG No data
1075399303_1075399313 25 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA No data
Right 1075399313 10:122150017-122150039 GTCCCGCTGGCTTCAGCCTGAGG No data
1075399303_1075399308 -7 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA No data
Right 1075399308 10:122149985-122150007 AATGTGAGCTGCCGCGGAGTGGG No data
1075399303_1075399307 -8 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA No data
Right 1075399307 10:122149984-122150006 AAATGTGAGCTGCCGCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399303 Original CRISPR TCACATTTCGGAGACTGAGC GGG (reversed) Intronic