ID: 1075399304

View in Genome Browser
Species Human (GRCh38)
Location 10:122149970-122149992
Sequence CTCACATTTCGGAGACTGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399304_1075399313 24 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399313 10:122150017-122150039 GTCCCGCTGGCTTCAGCCTGAGG No data
1075399304_1075399310 -1 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399310 10:122149992-122150014 GCTGCCGCGGAGTGGGTGCTGGG No data
1075399304_1075399316 30 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG No data
1075399304_1075399312 11 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399312 10:122150004-122150026 TGGGTGCTGGGCTGTCCCGCTGG No data
1075399304_1075399308 -8 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399308 10:122149985-122150007 AATGTGAGCTGCCGCGGAGTGGG No data
1075399304_1075399307 -9 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399307 10:122149984-122150006 AAATGTGAGCTGCCGCGGAGTGG No data
1075399304_1075399309 -2 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399304 Original CRISPR CTCACATTTCGGAGACTGAG CGG (reversed) Intronic