ID: 1075399306

View in Genome Browser
Species Human (GRCh38)
Location 10:122149981-122150003
Sequence CTCCGCGGCAGCTCACATTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399306_1075399312 0 Left 1075399306 10:122149981-122150003 CCGAAATGTGAGCTGCCGCGGAG No data
Right 1075399312 10:122150004-122150026 TGGGTGCTGGGCTGTCCCGCTGG No data
1075399306_1075399318 28 Left 1075399306 10:122149981-122150003 CCGAAATGTGAGCTGCCGCGGAG No data
Right 1075399318 10:122150032-122150054 GCCTGAGGAGCAGGAGCAGAGGG No data
1075399306_1075399316 19 Left 1075399306 10:122149981-122150003 CCGAAATGTGAGCTGCCGCGGAG No data
Right 1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG No data
1075399306_1075399317 27 Left 1075399306 10:122149981-122150003 CCGAAATGTGAGCTGCCGCGGAG No data
Right 1075399317 10:122150031-122150053 AGCCTGAGGAGCAGGAGCAGAGG No data
1075399306_1075399313 13 Left 1075399306 10:122149981-122150003 CCGAAATGTGAGCTGCCGCGGAG No data
Right 1075399313 10:122150017-122150039 GTCCCGCTGGCTTCAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399306 Original CRISPR CTCCGCGGCAGCTCACATTT CGG (reversed) Intronic
No off target data available for this crispr