ID: 1075399307

View in Genome Browser
Species Human (GRCh38)
Location 10:122149984-122150006
Sequence AAATGTGAGCTGCCGCGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399300_1075399307 1 Left 1075399300 10:122149960-122149982 CCCCTGGTTCCCGCTCAGTCTCC No data
Right 1075399307 10:122149984-122150006 AAATGTGAGCTGCCGCGGAGTGG No data
1075399304_1075399307 -9 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399307 10:122149984-122150006 AAATGTGAGCTGCCGCGGAGTGG No data
1075399302_1075399307 -1 Left 1075399302 10:122149962-122149984 CCTGGTTCCCGCTCAGTCTCCGA No data
Right 1075399307 10:122149984-122150006 AAATGTGAGCTGCCGCGGAGTGG No data
1075399303_1075399307 -8 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA No data
Right 1075399307 10:122149984-122150006 AAATGTGAGCTGCCGCGGAGTGG No data
1075399301_1075399307 0 Left 1075399301 10:122149961-122149983 CCCTGGTTCCCGCTCAGTCTCCG No data
Right 1075399307 10:122149984-122150006 AAATGTGAGCTGCCGCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399307 Original CRISPR AAATGTGAGCTGCCGCGGAG TGG Intronic