ID: 1075399309

View in Genome Browser
Species Human (GRCh38)
Location 10:122149991-122150013
Sequence AGCTGCCGCGGAGTGGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399304_1075399309 -2 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG No data
1075399300_1075399309 8 Left 1075399300 10:122149960-122149982 CCCCTGGTTCCCGCTCAGTCTCC 0: 1
1: 0
2: 2
3: 21
4: 234
Right 1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG No data
1075399301_1075399309 7 Left 1075399301 10:122149961-122149983 CCCTGGTTCCCGCTCAGTCTCCG 0: 1
1: 0
2: 0
3: 5
4: 119
Right 1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG No data
1075399302_1075399309 6 Left 1075399302 10:122149962-122149984 CCTGGTTCCCGCTCAGTCTCCGA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG No data
1075399303_1075399309 -1 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1075399309 10:122149991-122150013 AGCTGCCGCGGAGTGGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399309 Original CRISPR AGCTGCCGCGGAGTGGGTGC TGG Intronic
No off target data available for this crispr