ID: 1075399311

View in Genome Browser
Species Human (GRCh38)
Location 10:122149996-122150018
Sequence ACAGCCCAGCACCCACTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399311_1075399313 -2 Left 1075399311 10:122149996-122150018 CCGCGGAGTGGGTGCTGGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1075399313 10:122150017-122150039 GTCCCGCTGGCTTCAGCCTGAGG No data
1075399311_1075399316 4 Left 1075399311 10:122149996-122150018 CCGCGGAGTGGGTGCTGGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG No data
1075399311_1075399318 13 Left 1075399311 10:122149996-122150018 CCGCGGAGTGGGTGCTGGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1075399318 10:122150032-122150054 GCCTGAGGAGCAGGAGCAGAGGG No data
1075399311_1075399321 30 Left 1075399311 10:122149996-122150018 CCGCGGAGTGGGTGCTGGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1075399321 10:122150049-122150071 AGAGGGCGTCAGTTAGATGGTGG No data
1075399311_1075399317 12 Left 1075399311 10:122149996-122150018 CCGCGGAGTGGGTGCTGGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1075399317 10:122150031-122150053 AGCCTGAGGAGCAGGAGCAGAGG No data
1075399311_1075399320 27 Left 1075399311 10:122149996-122150018 CCGCGGAGTGGGTGCTGGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1075399320 10:122150046-122150068 AGCAGAGGGCGTCAGTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399311 Original CRISPR ACAGCCCAGCACCCACTCCG CGG (reversed) Intronic
900157277 1:1208305-1208327 ACACCCCTGCAGCCCCTCCGGGG - Intergenic
900525278 1:3125463-3125485 ACAGCCCAGCAGCCGCTGAGTGG - Intronic
901049358 1:6418751-6418773 CCAGCCCAGTACCCACACCCAGG - Exonic
901255978 1:7827254-7827276 ACAGCCCTGCTGCCCCTCCGCGG + Exonic
903656042 1:24949443-24949465 CCTGCCCAGCACCCACACCAAGG + Intronic
903769788 1:25756656-25756678 ACAGCCCCGCACTCACCCAGAGG - Intronic
904865708 1:33577413-33577435 CCAGACCAGCACCCAGCCCGGGG - Exonic
906749585 1:48247134-48247156 CCAGCTCAGCACCCAGTCTGTGG + Intronic
912250858 1:108011115-108011137 AAAGCCCAGAACCAACTCTGAGG - Intergenic
917789725 1:178491884-178491906 GCAGCCCAGCTCTCACTCTGGGG - Intergenic
918378197 1:183930091-183930113 ACAGCCCATCAACCAGTCCCCGG + Intronic
920110606 1:203584501-203584523 GCAGCCCAGCACCTTCTCAGAGG + Intergenic
923624986 1:235606552-235606574 ACAGCACAGCACCATCTCCCTGG - Intronic
924422851 1:243925335-243925357 ACAGCTCAGCTCCCACACCCTGG - Intergenic
1065288635 10:24208901-24208923 AGAGCCCAGCCCCCAGTCCCCGG + Intronic
1067083542 10:43226623-43226645 GCAGCCCAGAACCCACACAGTGG + Intronic
1069747823 10:70726987-70727009 AAAGACCAGCACCCACTGAGGGG - Intronic
1070807026 10:79276643-79276665 ACAGCCCTGCAGACACTCCTAGG + Intronic
1072740424 10:97905854-97905876 CTCCCCCAGCACCCACTCCGTGG - Intronic
1073688726 10:105784284-105784306 ACAGCCCAGCAGCCAATTAGTGG + Intergenic
1074683214 10:115931917-115931939 ACTGCCCTGCATCCACTCCATGG - Intronic
1075399311 10:122149996-122150018 ACAGCCCAGCACCCACTCCGCGG - Intronic
1076432238 10:130412467-130412489 ACAGCCCAGCACCCTCCCTGTGG - Intergenic
1076532790 10:131155789-131155811 ACGGCCCACCCCCCACTCCCTGG + Intronic
1076697661 10:132254876-132254898 ACTGTCCAGCACCCACTTCCCGG - Intronic
1076894449 10:133303122-133303144 ACAGCCCAGCAGCCTCTCAGAGG + Intronic
1076894467 10:133303182-133303204 ACACCCCAGCAGCCTCTCAGAGG + Intronic
1076894504 10:133303301-133303323 ACACCCCAGCAGCCTCTCAGAGG + Intronic
1077625596 11:3768580-3768602 ACAGCCAAGCACCAACACCATGG - Exonic
1078222371 11:9362590-9362612 AGAACCCAGCACACACTCTGTGG - Intergenic
1081537332 11:44005261-44005283 AAAGCCCATCAGCCAATCCGGGG - Intergenic
1083581243 11:63826919-63826941 CCTGCCCAGCTCCCCCTCCGGGG + Exonic
1083674045 11:64315798-64315820 GCCGCTCAGCACCCCCTCCGGGG - Exonic
1084029380 11:66472269-66472291 AAGGCCCAGCAGCCACTCCCTGG - Intronic
1084180051 11:67441660-67441682 ACATCCCAGCAGCCCCTCCAGGG - Intronic
1084579766 11:70015819-70015841 CCTGCCCAGCACCCTCTCCCAGG - Intergenic
1084768540 11:71327689-71327711 ACAGCCCAGCTCCCACAGCCAGG - Intergenic
1087130933 11:94668766-94668788 AAAGCCCAGCTCCCACCCAGGGG + Intergenic
1088167618 11:106957070-106957092 ACAGCCCAACACACCCTCTGTGG - Intronic
1088779404 11:113119860-113119882 ACAACCCAGCACCCTGTCTGGGG + Intronic
1089335991 11:117724383-117724405 ACAGCCCAGCCCCCTCTTCCTGG - Intronic
1089520151 11:119057607-119057629 GCAGGCCAGCGCCCCCTCCGCGG - Intergenic
1090851853 11:130577843-130577865 ACAGCCCTGCACCCACGCCAGGG - Intergenic
1091584152 12:1806407-1806429 AGAGCCAAGCAGCCACTCCCTGG + Intronic
1092225587 12:6746235-6746257 TCAGCCCAGCACTTACTCCTGGG - Intergenic
1095862098 12:46928771-46928793 ACAGACCTGTACCCAGTCCGTGG - Intergenic
1095958365 12:47819287-47819309 AAAGCCCAGCCCCAACTCAGTGG + Intronic
1096195745 12:49647847-49647869 TCAGCCCAGCTCCCACACCACGG + Intronic
1096241367 12:49961882-49961904 ACTGTCCCGCGCCCACTCCGAGG - Exonic
1096585174 12:52615225-52615247 TTAGCCCAGCACCCACTGCTGGG + Intronic
1099817824 12:87670658-87670680 CCAGCCCAGCAGCCAATCAGAGG + Intergenic
1103308807 12:119988926-119988948 CCAGCCTTGCACCCACTTCGGGG - Intergenic
1104661197 12:130612506-130612528 CCAGCCCAGCACCCAGTCTGGGG + Intronic
1104963825 12:132500295-132500317 ACAGCACAGCACCCACAGTGGGG - Intronic
1106360007 13:29022318-29022340 ACAGCCCATCACCCAACCCAAGG - Intronic
1108280343 13:48854980-48855002 ATAGCCCAGGACCTACTCCCAGG + Intergenic
1113879691 13:113617288-113617310 ACAGCCAGGCACCCGCTCCATGG - Intronic
1114482093 14:23042289-23042311 ACAGCCCAGCCGCCAGCCCGAGG - Exonic
1116436162 14:44897412-44897434 AGAGCCCAGAACTCACGCCGGGG + Exonic
1121016864 14:90554240-90554262 ACAGTCCCCCACCCACTCTGCGG + Intronic
1122206656 14:100151002-100151024 ACAGCCCAGAGTCCACTCAGAGG - Intronic
1122448395 14:101783762-101783784 CCAGCCCAGCACTCACAGCGAGG - Intronic
1122550414 14:102546103-102546125 TGAGCCCAGCACCCTCTCCATGG + Intergenic
1122783399 14:104153247-104153269 CCAGCCCAGCAGCCACTGCCAGG - Intronic
1122793058 14:104192554-104192576 ACAGCTCAGCACCCACAGCCTGG + Intergenic
1122985176 14:105208583-105208605 GCACCCCAGCACCCAGGCCGAGG + Intergenic
1123702864 15:22928553-22928575 ACAGCCCCGCGCCCAGCCCGCGG - Intronic
1125609731 15:40961889-40961911 TCAGCCTCCCACCCACTCCGTGG + Intergenic
1125755318 15:42060364-42060386 ACAGACCAGCCCCCACCCCGAGG + Intergenic
1128129189 15:65214508-65214530 TCAGCCCAGCACTCACACTGAGG + Intergenic
1128325401 15:66720777-66720799 ACTGCCCAGCTCCCACCCTGAGG - Intronic
1128370465 15:67035754-67035776 ACAGCCCCACCCCCACCCCGTGG - Intergenic
1129108785 15:73325524-73325546 ACATCCGGGCACCCACCCCGGGG + Intronic
1129541126 15:76347411-76347433 CCAGCCGAGCCCCCACCCCGCGG - Intergenic
1130050241 15:80478436-80478458 ACAGTCCAGTGTCCACTCCGAGG - Intronic
1132686264 16:1163379-1163401 CCAGACCAGCACCCCCTCCCGGG - Intronic
1132989747 16:2786662-2786684 CCAGCCCGTCACCCCCTCCGTGG + Exonic
1133031369 16:3012810-3012832 CCAGCCCCGCACCCTCCCCGTGG + Exonic
1133898196 16:9949235-9949257 ACAGCCCAGCTCCCAGTACATGG + Intronic
1134182900 16:12061856-12061878 TCAGCCCAACACTCACTCCACGG - Intronic
1138351113 16:56346735-56346757 ACAGCCCAGCTCCCACTGGCAGG + Exonic
1138589971 16:57994296-57994318 ACAGGTCAGCTCCCACTTCGGGG + Intergenic
1141241106 16:82266092-82266114 AAAGCCCAGCAGCCTCTCTGGGG - Intergenic
1141561226 16:84868945-84868967 ACAGCCCAGCACAGACTCAGAGG - Intronic
1141586438 16:85036751-85036773 CCAGCCCAGCACCCCCTGCCCGG + Intronic
1142142593 16:88479200-88479222 CCAGCCCAGCACCACCTGCGTGG - Intronic
1143317529 17:6043784-6043806 CCTGCCCAGCACCCAGTCAGTGG - Intronic
1143400623 17:6640116-6640138 ACAGCGCGTCTCCCACTCCGAGG + Intronic
1143749992 17:9021256-9021278 CCGGCCCAGCCCCCTCTCCGGGG + Intergenic
1144839908 17:18179489-18179511 ACAGACCATCCCCCACTCCTTGG + Exonic
1147577289 17:41610121-41610143 AGGGCCCAGCCCCCACTCCATGG + Intronic
1147947393 17:44087645-44087667 GCAGCCCACCACCCACCCTGAGG - Exonic
1148543148 17:48496168-48496190 ACAGCCCAGCAACCACACTGAGG + Intergenic
1152566316 17:81101965-81101987 ACAGCCCCGCTCTCACTCCCTGG - Intronic
1152676562 17:81644425-81644447 ACATCCCAGCACCCATTCTTCGG - Intronic
1152717116 17:81905505-81905527 ACAGCCCAGCACAGGCCCCGGGG + Intronic
1155687517 18:28573892-28573914 ACACCTCATCACCCACTCAGTGG - Intergenic
1157696260 18:49726119-49726141 ACAGCCCGACCCCCACTCCCTGG - Intergenic
1160995481 19:1880282-1880304 ACAGCACAGCTCCATCTCCGAGG + Intronic
1161646467 19:5456249-5456271 ACAGCCCAGCACCCAGGACACGG - Exonic
1161767988 19:6217338-6217360 AGACCCCAGCACCCACTCCCAGG - Intronic
1162040459 19:7968145-7968167 ACACCCACGCACCCACTCTGTGG - Intronic
1162585111 19:11553640-11553662 ACAGCCCAGGACCCACACCCTGG + Exonic
1162790468 19:13060270-13060292 AGAGCCCAGCCCCCACTCTGAGG + Intronic
1165095870 19:33409720-33409742 GCAGCCCTGCCCCCACACCGTGG - Intronic
1165490143 19:36118742-36118764 ACAACCCAGCAAACACTCCAAGG + Intronic
1165729148 19:38133265-38133287 ACAGCCCAGCAGCCACTGCTAGG + Intronic
1166147365 19:40846850-40846872 ACACCCCAGCAGCCACTGCGGGG - Intronic
1166151515 19:40878735-40878757 ACACCCCAGCAGCCAGTGCGGGG - Intronic
1168462457 19:56570540-56570562 ACAGCCCAGTGCCCTCTCAGAGG + Intronic
1168540211 19:57203788-57203810 ACTACCCACCACCCACTCTGTGG + Intronic
1168612892 19:57815086-57815108 AAAGCCCAGCTCCACCTCCGGGG + Intronic
1168698170 19:58417874-58417896 ACATCCCAACACCCACCCCAGGG + Exonic
925067467 2:939520-939542 ACAGCGCAGCCCCCAGTCTGAGG - Intergenic
927520741 2:23696585-23696607 ACCTCCCAACACCCACTCAGTGG + Intronic
929872579 2:45771522-45771544 ACAACACAGCACACACTCTGTGG + Intronic
929956198 2:46460509-46460531 CCAGCCCAGCTCCCACCACGTGG + Intronic
930262657 2:49165732-49165754 TCAAGCCAGCACCCACTCCTTGG + Intergenic
934528922 2:95073008-95073030 ACAGCCCAGGACCCAAGCCTTGG + Intergenic
937048540 2:118868252-118868274 ACAGCCCAGCCCACACTTAGTGG - Intergenic
938763991 2:134448427-134448449 ACACCCCTGCACACACTCCCTGG + Intronic
939986030 2:148830653-148830675 GCAGCCCAGCACCCACCCACTGG - Intergenic
945257353 2:207813551-207813573 AGAGCCCTGCACCCCCTCTGTGG - Intergenic
946001313 2:216484993-216485015 ACACCCCAGCACCAACCCCACGG - Intergenic
947767264 2:232645687-232645709 ACAGCCCTGCACACAGTCAGTGG - Intronic
948602554 2:239115714-239115736 ACAGCCCACCACCCACTCAGCGG + Intronic
949076719 2:242063970-242063992 ACAGCCCAGCCCCTACCCTGAGG + Intergenic
1171170945 20:23015020-23015042 ACTGCCCAGCATTCACTCCCAGG + Intergenic
1171335263 20:24379783-24379805 CCTGCCCAGCAGCCACTCCCAGG - Intergenic
1174082750 20:47982823-47982845 CCTGCCCACCACCCACTGCGAGG + Intergenic
1179176398 21:39010954-39010976 ACCCCCCAGCACCCACCCCAGGG - Intergenic
1179934856 21:44596316-44596338 ACATCCCATCACCCTCTCTGTGG + Intronic
1180039844 21:45270132-45270154 ACAGCCCTGGAGCCACCCCGTGG - Intronic
1180067422 21:45419512-45419534 GCAGCCCAGCTCCCACCCCAGGG - Intronic
1180736952 22:18024429-18024451 ACAGCCCAGCCCCCTCGCCCAGG + Exonic
1183167412 22:36158355-36158377 ATGGCACAGCACCCACTCCTAGG + Intronic
1184045316 22:41969448-41969470 CCAGCCCAGCACGGTCTCCGGGG + Intergenic
1184251025 22:43260410-43260432 AGAGCCCAGGACCCACTCCAGGG - Intronic
1184796206 22:46734531-46734553 GCAGCCCAGCACCTTCTCCTGGG - Intronic
949600906 3:5596810-5596832 ACTGTCCTGCACCCACTCTGTGG + Intergenic
950123176 3:10495271-10495293 AAAGCCCAGCACCCTGTCCATGG - Intronic
951500928 3:23386275-23386297 ATAGAACAGCACCCTCTCCGTGG + Intronic
952496616 3:33921528-33921550 AAAGCCCAGCTCCCACCCCTGGG + Intergenic
953772156 3:45785987-45786009 CCAGCTCAGCACCCACTACCAGG + Intronic
954300697 3:49699386-49699408 ACTGCCCACCCCCCACCCCGGGG - Intronic
954369846 3:50164423-50164445 ACAGCCAAGAGCCCACTCTGAGG - Intronic
954631770 3:52051656-52051678 CCAGCCCAGCCCCCAGTCCCAGG - Intronic
954885734 3:53871618-53871640 ACTGCCCAGCACCCATTCCCAGG + Intronic
958755311 3:98244765-98244787 ACAGCCCAGGACTCAGTCAGGGG + Intergenic
961648295 3:128404455-128404477 CCAGCCCAGCACAGACGCCGGGG + Intronic
968046036 3:195624363-195624385 ACAGCACAGCACCCAGCCCTCGG + Intergenic
968308618 3:197665724-197665746 ACAGCACAGCACCCAGCCCTCGG - Intergenic
968471708 4:785649-785671 CCTGCCCAGCACCTCCTCCGTGG - Exonic
968494760 4:909479-909501 ACAGCCCAGCACGGACTGCATGG + Intronic
968872466 4:3248765-3248787 ACAGCCCAGGACCCCCACCAGGG + Exonic
969531287 4:7732554-7732576 ACAACCCAGCACCACCTCCTGGG + Intronic
969703674 4:8780993-8781015 CCAGCCCAGCAGCCCCTCAGGGG - Intergenic
969737957 4:9003794-9003816 ACAGCCTAGGAGCCACTCCAAGG - Intergenic
969797154 4:9535348-9535370 ACAGCCTAGGAGCCACTCCAAGG - Intergenic
969814377 4:9675793-9675815 CCTGCTCAGCACCCACTCCCTGG - Intergenic
970546510 4:17135594-17135616 TGAGCCCAGGACCCACTCAGGGG + Intergenic
971554942 4:28002068-28002090 CCATCCCAGCACCCATTCGGTGG - Intergenic
975242910 4:72082815-72082837 CCACCCCAGCCCCCACTCCCTGG + Intronic
977726656 4:100304025-100304047 ACAGCCTAGCATCCACTTCTAGG - Intergenic
981237549 4:142436112-142436134 ACAGCCCAGCACACAGGCTGTGG + Intronic
984844504 4:184098257-184098279 ACAGGACAGCCCCCACTCAGAGG - Intronic
985065688 4:186118816-186118838 CCAGCCAAGCACCCACTGCCTGG + Intronic
985495760 5:204156-204178 ACACCCCAGGATCCACTCCCTGG - Exonic
985747278 5:1654512-1654534 ACAGCACAGCACCCAGCCCTCGG - Intergenic
986315534 5:6584054-6584076 GCCGCACAGCCCCCACTCCGAGG + Intergenic
987065675 5:14287283-14287305 ACAGCCCATCACCCAACCCAAGG - Intronic
987261083 5:16204093-16204115 CCAGCCCAGGACCCACTCCCAGG + Intergenic
993996458 5:94729336-94729358 ACTGCCAAGCACCCGCTCCATGG - Intronic
998016412 5:138735635-138735657 CCAGCCCAGCTCCAACTCTGTGG - Intronic
998041871 5:138955627-138955649 GCTGCCCAGCACACACCCCGGGG + Intronic
999318963 5:150601466-150601488 ACAGCCCCTCACCCACCCTGGGG - Intronic
1001600762 5:172926655-172926677 CCTGTCCAGCACCCACTCCAAGG + Intronic
1002777421 6:341020-341042 ACAGACCAGCACCCTCTGCCTGG - Intronic
1004171978 6:13302371-13302393 AAAGGCCAGCACCCCCACCGTGG + Intronic
1005510599 6:26508758-26508780 ACAGCCCAGAACCCATTCTCAGG - Exonic
1007306993 6:40914710-40914732 ACTGCCCACCGCCCACTCCCAGG + Intergenic
1016254533 6:142088527-142088549 ACAGCGGATCACCAACTCCGTGG + Exonic
1016994918 6:149954750-149954772 GCAGCGGCGCACCCACTCCGGGG + Intergenic
1017003691 6:150014686-150014708 GCAGCGGCGCACCCACTCCGGGG - Intergenic
1017311872 6:152984244-152984266 ACAGCCAAGAACTCACTCCGAGG - Intergenic
1017718505 6:157228695-157228717 CCAGCCCAGCACCAACTGCCCGG + Intergenic
1018654966 6:166026046-166026068 CCAGCCCAGCATCCCCTCTGAGG + Intergenic
1018825398 6:167404914-167404936 ACAGCCCAGCCCCCTCCCCGGGG + Intergenic
1019343604 7:519580-519602 GCGGCCCAGCACCCCCTCCGCGG + Intronic
1019593476 7:1847468-1847490 ACAACCCAGCCCCCACTGGGCGG + Exonic
1020082605 7:5294954-5294976 GCAGCCCAGCACCCCCTCCCCGG - Intronic
1023075202 7:36474750-36474772 ACTGCCCAGACCCCACTCCCAGG - Intergenic
1026968597 7:74454712-74454734 ACAGGCCAGCCCCCTCCCCGGGG - Intronic
1030715101 7:112800459-112800481 CCAGCCCAGCACCCCCTCACTGG - Intergenic
1030771777 7:113484444-113484466 CCACCCCACCACCCAGTCCGTGG + Intergenic
1030981187 7:116186652-116186674 AACTCCCAGCACCCACTCCAGGG - Intergenic
1034415477 7:150962271-150962293 AGACCCCAGCACCCACCCCAGGG + Intronic
1036685583 8:10907808-10907830 ACAGCCGAGGACCCACCCCGCGG + Intronic
1036829679 8:12012087-12012109 ACAGCCTAGGAGCCACTCCAAGG + Intergenic
1037827185 8:22166353-22166375 ACAGGCAAACACACACTCCGGGG - Intronic
1038963791 8:32549142-32549164 ATAGCCCAGGTCCCACTCCCGGG - Intronic
1040947131 8:52895264-52895286 CCAGCTTAGCAGCCACTCCGGGG + Intergenic
1042949176 8:74183156-74183178 TGAGCCCAGCACCCACCCAGAGG - Intergenic
1043812341 8:84756397-84756419 ACATAGCAGCCCCCACTCCGTGG + Intronic
1047227982 8:122972823-122972845 ACAGCCCTGCAGCCACTAAGGGG + Intronic
1049194454 8:141307939-141307961 CCAGCCCCGCACCTTCTCCGGGG - Intronic
1049326123 8:142022407-142022429 CCAGCCCAGCACCCACACCCCGG - Intergenic
1049596729 8:143487837-143487859 ACAGAACAGCACCCGCTCCACGG + Intronic
1057220906 9:93257264-93257286 CCAGCCCAGCCCCAACTCCCTGG - Intronic
1057563172 9:96144836-96144858 CCACCCCAGCACCCACTACCTGG + Intergenic
1059419647 9:114183099-114183121 CAACCCCAGCACCCACTCCATGG - Intronic
1059776538 9:117481523-117481545 TCAGTCCAGAACCCACTCCCTGG - Intergenic
1059779369 9:117509953-117509975 ACAGGCAAGCCCCCACACCGAGG + Intergenic
1060589523 9:124808100-124808122 TCAGCCCAGAACCCCCTCCTTGG - Intronic
1060729003 9:126025258-126025280 ACAGCCCACCACGCAGGCCGTGG - Intergenic
1060793734 9:126501625-126501647 ACAGCCCAGCACCACGTCCATGG - Intronic
1061001150 9:127903724-127903746 ACCGCCCTGCCCCCACTCCATGG - Intronic
1061131893 9:128713125-128713147 ACTGGCCAGCAGCCCCTCCGAGG + Exonic
1062419893 9:136475438-136475460 AGAGCCCAGCAACGACTCTGTGG - Exonic
1185910414 X:3975825-3975847 ACAGCCCAGCACCACATCCTGGG + Intergenic
1188092158 X:25977113-25977135 ACAGCCCAGCACACCCGCTGTGG + Intergenic
1189279090 X:39808715-39808737 CCAGCCCAGCACCCACCCCAAGG + Intergenic
1189658957 X:43277786-43277808 CCAGCCCAGCCCCCACCCCAGGG - Intergenic
1190067058 X:47248702-47248724 CAAGCCAAGCACCCACTCCAGGG - Intergenic
1190797652 X:53759760-53759782 AAGGCCCAGCACCCACTCCATGG + Intergenic
1191019087 X:55841330-55841352 ACAGCACAGCACCCCATCCTAGG - Intergenic
1198860915 X:141069591-141069613 ACTGCCCAGCTCCCACTTCAAGG + Intergenic
1198901777 X:141517792-141517814 ACTGCCCAGCTCCCACTTCAAGG - Intergenic
1199976024 X:152895371-152895393 ACAGGCCAGCTCCCACCCCCTGG - Intergenic