ID: 1075399313

View in Genome Browser
Species Human (GRCh38)
Location 10:122150017-122150039
Sequence GTCCCGCTGGCTTCAGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399306_1075399313 13 Left 1075399306 10:122149981-122150003 CCGAAATGTGAGCTGCCGCGGAG No data
Right 1075399313 10:122150017-122150039 GTCCCGCTGGCTTCAGCCTGAGG No data
1075399311_1075399313 -2 Left 1075399311 10:122149996-122150018 CCGCGGAGTGGGTGCTGGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1075399313 10:122150017-122150039 GTCCCGCTGGCTTCAGCCTGAGG No data
1075399304_1075399313 24 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399313 10:122150017-122150039 GTCCCGCTGGCTTCAGCCTGAGG No data
1075399303_1075399313 25 Left 1075399303 10:122149969-122149991 CCCGCTCAGTCTCCGAAATGTGA 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1075399313 10:122150017-122150039 GTCCCGCTGGCTTCAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399313 Original CRISPR GTCCCGCTGGCTTCAGCCTG AGG Intronic
No off target data available for this crispr