ID: 1075399316

View in Genome Browser
Species Human (GRCh38)
Location 10:122150023-122150045
Sequence CTGGCTTCAGCCTGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399306_1075399316 19 Left 1075399306 10:122149981-122150003 CCGAAATGTGAGCTGCCGCGGAG No data
Right 1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG No data
1075399304_1075399316 30 Left 1075399304 10:122149970-122149992 CCGCTCAGTCTCCGAAATGTGAG No data
Right 1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG No data
1075399311_1075399316 4 Left 1075399311 10:122149996-122150018 CCGCGGAGTGGGTGCTGGGCTGT 0: 1
1: 0
2: 1
3: 23
4: 204
Right 1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399316 Original CRISPR CTGGCTTCAGCCTGAGGAGC AGG Intronic
No off target data available for this crispr