ID: 1075399510

View in Genome Browser
Species Human (GRCh38)
Location 10:122150870-122150892
Sequence TCCGTGGCATAGAATCAACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399510_1075399517 -1 Left 1075399510 10:122150870-122150892 CCCGGTTGATTCTATGCCACGGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1075399517 10:122150892-122150914 ACTATTCGGAAGGTGGCGCAGGG No data
1075399510_1075399521 26 Left 1075399510 10:122150870-122150892 CCCGGTTGATTCTATGCCACGGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1075399521 10:122150919-122150941 GAGCATGAAGTTGGAAAGACAGG No data
1075399510_1075399520 17 Left 1075399510 10:122150870-122150892 CCCGGTTGATTCTATGCCACGGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG No data
1075399510_1075399518 0 Left 1075399510 10:122150870-122150892 CCCGGTTGATTCTATGCCACGGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1075399518 10:122150893-122150915 CTATTCGGAAGGTGGCGCAGGGG No data
1075399510_1075399514 -8 Left 1075399510 10:122150870-122150892 CCCGGTTGATTCTATGCCACGGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1075399514 10:122150885-122150907 GCCACGGACTATTCGGAAGGTGG No data
1075399510_1075399516 -2 Left 1075399510 10:122150870-122150892 CCCGGTTGATTCTATGCCACGGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1075399516 10:122150891-122150913 GACTATTCGGAAGGTGGCGCAGG No data
1075399510_1075399519 4 Left 1075399510 10:122150870-122150892 CCCGGTTGATTCTATGCCACGGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1075399519 10:122150897-122150919 TCGGAAGGTGGCGCAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399510 Original CRISPR TCCGTGGCATAGAATCAACC GGG (reversed) Intronic
901176071 1:7300251-7300273 ACCCTGGCACAGAATCACCCTGG + Intronic
903500014 1:23795548-23795570 CCCCTGGAATAGAATCAGCCAGG - Intergenic
904431465 1:30467241-30467263 TCCGTCACATGGAATCAACCAGG - Intergenic
909761421 1:79292381-79292403 TACCTGGCATAGAATAAAACTGG - Intergenic
913111635 1:115662604-115662626 TCAAGGGCATAGAAACAACCAGG - Intronic
917818099 1:178731179-178731201 TCCCTGCCATATTATCAACCAGG - Intronic
921384204 1:214552455-214552477 TCTGTGGCATGGAACAAACCGGG - Intergenic
921643509 1:217584646-217584668 TCAGAGGCATGGAAGCAACCAGG + Intronic
1065453988 10:25887477-25887499 TCCTTGGTATAAAATCAATCAGG - Intergenic
1065494493 10:26314805-26314827 TGCGTGGAATAGAATCAGCCAGG + Intergenic
1070145985 10:73773529-73773551 TACCTGGCATACAAGCAACCTGG + Exonic
1072535741 10:96361337-96361359 TGACTGGCGTAGAATCAACCTGG + Intergenic
1075289644 10:121217399-121217421 TCCGTGGGAAAGAATCACTCTGG + Intergenic
1075399510 10:122150870-122150892 TCCGTGGCATAGAATCAACCGGG - Intronic
1107133889 13:36923199-36923221 TCCGTGGATCAGAATCAAACTGG + Intergenic
1111140551 13:84112809-84112831 TCTTTGGCATATCATCAACCTGG + Intergenic
1118659475 14:67992098-67992120 TCCGATGCATAGAATAAAGCGGG - Intronic
1122014497 14:98782770-98782792 TCGGTGGCAGCGAATCAACGAGG - Intergenic
1127996214 15:64154365-64154387 TCTGTGGGATAGAATTAAACAGG - Exonic
1138637264 16:58350780-58350802 ACCGTGATATGGAATCAACCTGG + Intronic
1147181780 17:38691069-38691091 TCAGTCCCACAGAATCAACCTGG - Intergenic
1151079517 17:71312508-71312530 TCCGTGGCATAGGAAAAAGCAGG - Intergenic
1155610487 18:27661777-27661799 TCCATGGCAGAAAATCACCCTGG + Intergenic
928946188 2:36774232-36774254 CCCGTGGCATAGAATTACTCAGG - Intronic
939583907 2:143984447-143984469 TCCTTAGCAGAGAATCAACAGGG + Intronic
941864244 2:170317438-170317460 CCCTTTGCATAGAATCATCCAGG - Intronic
947305449 2:228741117-228741139 ATCGTGGCATAGAAACAAACTGG - Intergenic
948283397 2:236765976-236765998 ACCCTAGCATAGAATAAACCAGG + Intergenic
1183238250 22:36636425-36636447 TCTGTGGCATACACACAACCTGG + Intronic
968558674 4:1264567-1264589 TACGTGGCACATAATCAAACTGG + Intergenic
969119983 4:4901006-4901028 TGAGTGGCTTAGATTCAACCTGG - Intergenic
976621781 4:87135709-87135731 CCCAAGGCATTGAATCAACCTGG - Exonic
976633196 4:87260804-87260826 TCTTTGGAATAAAATCAACCCGG + Intergenic
976963834 4:91011595-91011617 TCAGTGTCATAGACACAACCTGG - Intronic
981057692 4:140382613-140382635 TCTGTGGCATTGAATAACCCTGG - Exonic
984556241 4:181217609-181217631 ACAGTGGCATAGAATAATCCAGG + Intergenic
984556403 4:181219082-181219104 ACAGTGGCATAGAATAATCCAGG - Intergenic
992734791 5:79708203-79708225 TCCGTGGGATAGAAACAGCATGG - Intronic
1015855295 6:137618006-137618028 TCAGTGTCTTAGAGTCAACCTGG + Intergenic
1021512004 7:21443472-21443494 TCAGAGGGACAGAATCAACCTGG - Intronic
1021699846 7:23307469-23307491 TCAGTGGCACTGAAACAACCTGG + Intronic
1034383387 7:150718581-150718603 TCAGTGATATAGAATCACCCAGG + Intronic
1043858335 8:85287332-85287354 TAGGTGGCATAGTATCAGCCAGG + Intergenic
1052687046 9:31770208-31770230 GCCAAGACATAGAATCAACCTGG + Intergenic
1192143544 X:68665105-68665127 TCCTTGGTATAGCATCAACAAGG - Intronic