ID: 1075399511

View in Genome Browser
Species Human (GRCh38)
Location 10:122150871-122150893
Sequence GTCCGTGGCATAGAATCAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399511_1075399516 -3 Left 1075399511 10:122150871-122150893 CCGGTTGATTCTATGCCACGGAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1075399516 10:122150891-122150913 GACTATTCGGAAGGTGGCGCAGG No data
1075399511_1075399520 16 Left 1075399511 10:122150871-122150893 CCGGTTGATTCTATGCCACGGAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG No data
1075399511_1075399517 -2 Left 1075399511 10:122150871-122150893 CCGGTTGATTCTATGCCACGGAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1075399517 10:122150892-122150914 ACTATTCGGAAGGTGGCGCAGGG No data
1075399511_1075399519 3 Left 1075399511 10:122150871-122150893 CCGGTTGATTCTATGCCACGGAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1075399519 10:122150897-122150919 TCGGAAGGTGGCGCAGGGGAAGG No data
1075399511_1075399518 -1 Left 1075399511 10:122150871-122150893 CCGGTTGATTCTATGCCACGGAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1075399518 10:122150893-122150915 CTATTCGGAAGGTGGCGCAGGGG No data
1075399511_1075399521 25 Left 1075399511 10:122150871-122150893 CCGGTTGATTCTATGCCACGGAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1075399521 10:122150919-122150941 GAGCATGAAGTTGGAAAGACAGG No data
1075399511_1075399514 -9 Left 1075399511 10:122150871-122150893 CCGGTTGATTCTATGCCACGGAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1075399514 10:122150885-122150907 GCCACGGACTATTCGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399511 Original CRISPR GTCCGTGGCATAGAATCAAC CGG (reversed) Intronic
901892328 1:12277738-12277760 TTCCGAGGGATAGAAACAACTGG - Exonic
906079381 1:43074227-43074249 GTCATTGGCATAGCATCAAATGG + Intergenic
906104015 1:43280924-43280946 GGCTGTTGCATAGAATCAAAGGG - Intergenic
907798053 1:57737265-57737287 CTCCGTGGCATAGAACCATGTGG + Intronic
918690822 1:187477016-187477038 GTCCTGGGCATAGACTCATCTGG - Intergenic
1065105047 10:22374881-22374903 GTCCTTGGCGTAGAAATAACAGG + Intronic
1071992215 10:91110785-91110807 GTCCAGGGCAAAGAACCAACAGG + Intergenic
1075399511 10:122150871-122150893 GTCCGTGGCATAGAATCAACCGG - Intronic
1087351249 11:97035614-97035636 GTCCATGGCTTAGCCTCAACTGG + Intergenic
1095223967 12:39656187-39656209 GTCAGTGTCATAGAATGAGCTGG + Intronic
1099905571 12:88765670-88765692 GTCCGAGGCATAGTCTCAAGAGG - Intergenic
1106110920 13:26776164-26776186 GTTCGTAGCCTAGAAGCAACAGG + Intergenic
1114403578 14:22432809-22432831 GACCTTGGCAGAGACTCAACAGG - Intergenic
1118659476 14:67992099-67992121 GTCCGATGCATAGAATAAAGCGG - Intronic
1125697245 15:41649537-41649559 GTCAGTGATGTAGAATCAACAGG + Intronic
1159586104 18:70285052-70285074 GTCTGTAGCCTAGAAGCAACAGG + Intergenic
1161524908 19:4748208-4748230 GTCAGTGGCATCGAATCTCCTGG - Intergenic
928437457 2:31264184-31264206 GTCTGTGGCCTAGAAGCAATAGG - Intronic
933190838 2:79331552-79331574 GTCCGTGTAAGAGAATCCACTGG - Intronic
935627603 2:105184255-105184277 GACTGTGCCATAGAATCACCTGG - Intergenic
936172221 2:110186200-110186222 CTCACTGCCATAGAATCAACAGG + Intronic
936450039 2:112627024-112627046 CTCCGAGGCATAGAATCCTCGGG + Intergenic
937435369 2:121875748-121875770 GACCTTTGCATAGAATCATCTGG + Intergenic
939583906 2:143984446-143984468 TTCCTTAGCAGAGAATCAACAGG + Intronic
940332512 2:152490634-152490656 GGCCGTTGCATGGAAGCAACAGG - Intronic
947070498 2:226282971-226282993 GTGCATGGCAAATAATCAACAGG + Intergenic
1169900379 20:10546784-10546806 GTCAGTGGCATAGACACAGCAGG - Intronic
1178740117 21:35191643-35191665 GTCCTTGGCATAATATCAAGTGG - Intronic
968350357 3:198047682-198047704 GTCAGTGGAACCGAATCAACGGG - Intergenic
968360415 3:198143081-198143103 CTCCGTGTCATTGAATAAACTGG + Intergenic
970885929 4:20987447-20987469 GTGCCTGGCTTAGAATCAATGGG - Intronic
976953693 4:90866991-90867013 GTCCGTGGCCTATAAGGAACTGG - Intronic
981961387 4:150544028-150544050 GTCCTTAGAATAGTATCAACTGG + Intronic
990919146 5:60944189-60944211 GTCTGAGAAATAGAATCAACAGG - Intronic
991261787 5:64675810-64675832 GACAGTGGCCTGGAATCAACAGG - Intergenic
995256080 5:110048363-110048385 GTCCTTGGCATAGTATCTGCAGG - Intergenic
995545861 5:113229813-113229835 GTCTGTAGCATAGGAGCAACAGG + Intronic
1017033513 6:150245470-150245492 GTCCCTGGCACAGAATGGACAGG - Intronic
1018102044 6:160449021-160449043 GTCAGTGGAATAGAATCAAAGGG - Intronic
1023395226 7:39745693-39745715 GTCCCTGGACTAGAATCACCTGG - Intergenic
1037441790 8:18923613-18923635 GTTCGTGGCCTAGAAAAAACAGG + Intronic
1042626386 8:70762355-70762377 GTTCGTGGCATATTAGCAACTGG + Intronic
1050742202 9:8835077-8835099 GACAGTGGCATGGATTCAACTGG + Intronic
1057893879 9:98890741-98890763 GTGTGTGGCTTAGAATCCACTGG - Intergenic
1059745615 9:117197713-117197735 GTCAGTGGAATAGAATGAACAGG + Intronic
1185860230 X:3571628-3571650 GTTTGTAGCATAGGATCAACAGG + Intergenic
1193509989 X:82387922-82387944 GTCAGTGGCATAGAATCTGTTGG - Intergenic
1196594342 X:117525945-117525967 GTCTGTAGCATAGGATCAATAGG + Intergenic
1197439178 X:126469849-126469871 TTCCGTGGGTTAGAATCAACAGG - Intergenic