ID: 1075399515

View in Genome Browser
Species Human (GRCh38)
Location 10:122150886-122150908
Sequence GCCACCTTCCGAATAGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399515_1075399520 1 Left 1075399515 10:122150886-122150908 CCACGGACTATTCGGAAGGTGGC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG No data
1075399515_1075399521 10 Left 1075399515 10:122150886-122150908 CCACGGACTATTCGGAAGGTGGC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1075399521 10:122150919-122150941 GAGCATGAAGTTGGAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075399515 Original CRISPR GCCACCTTCCGAATAGTCCG TGG (reversed) Intronic
915430032 1:155859493-155859515 GCCTTCTTCCGAATGGTCCTCGG - Exonic
920580207 1:207099397-207099419 GCCCAGTTCCTAATAGTCCGTGG + Intronic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1094025236 12:25955027-25955049 TCCACCTTCAGTAAAGTCCGTGG - Intergenic
1119774489 14:77239914-77239936 GCCACCTTCAGAACAATCCAGGG + Intronic
1122937317 14:104966229-104966251 GCCACCTTCCTACTGCTCCGGGG + Intronic
1133915591 16:10106705-10106727 GCCAACTTCCCCAAAGTCCGTGG - Intronic
1142986035 17:3695837-3695859 CCCGCCTTCCCAAAAGTCCGCGG + Intronic
1157522857 18:48357210-48357232 GCCACCTGCAGAATAGGTCGGGG + Intronic
1173195098 20:40907763-40907785 GCCACCTTCCGGATACTGTGGGG - Intergenic
1176302698 21:5106121-5106143 CACACCTTCCGAATTTTCCGAGG - Intergenic
1179854326 21:44155802-44155824 CACACCTTCCGAATTTTCCGAGG + Intergenic
1001215884 5:169855385-169855407 GCCACTTTCCAAAAAGTCAGAGG - Intronic
1020800503 7:12726814-12726836 GCCACCTTCCCAATAGGTGGAGG - Intergenic
1050032846 9:1404588-1404610 GCCACCTGCCAAAAAGTCTGTGG - Intergenic
1056482121 9:87016262-87016284 GCCACCTTCAGAATAGATCCAGG - Intergenic
1062411116 9:136425079-136425101 TCCACCTACCGAGTAGCCCGAGG + Intergenic
1186661905 X:11676829-11676851 GGCACCATCCGAATAGTCCTTGG - Intergenic