ID: 1075399520

View in Genome Browser
Species Human (GRCh38)
Location 10:122150910-122150932
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075399515_1075399520 1 Left 1075399515 10:122150886-122150908 CCACGGACTATTCGGAAGGTGGC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG No data
1075399511_1075399520 16 Left 1075399511 10:122150871-122150893 CCGGTTGATTCTATGCCACGGAC 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG No data
1075399510_1075399520 17 Left 1075399510 10:122150870-122150892 CCCGGTTGATTCTATGCCACGGA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr