ID: 1075401472

View in Genome Browser
Species Human (GRCh38)
Location 10:122164070-122164092
Sequence CTCCAGGTTGCACAGGCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075401472_1075401483 10 Left 1075401472 10:122164070-122164092 CCTAATGCCTGTGCAACCTGGAG No data
Right 1075401483 10:122164103-122164125 CCTGGGGTTCTTCGCAGCCTTGG No data
1075401472_1075401484 24 Left 1075401472 10:122164070-122164092 CCTAATGCCTGTGCAACCTGGAG No data
Right 1075401484 10:122164117-122164139 CAGCCTTGGAAAGCTTTACCTGG No data
1075401472_1075401476 -8 Left 1075401472 10:122164070-122164092 CCTAATGCCTGTGCAACCTGGAG No data
Right 1075401476 10:122164085-122164107 ACCTGGAGCCCAGGCTGGCCTGG No data
1075401472_1075401486 26 Left 1075401472 10:122164070-122164092 CCTAATGCCTGTGCAACCTGGAG No data
Right 1075401486 10:122164119-122164141 GCCTTGGAAAGCTTTACCTGGGG No data
1075401472_1075401478 -7 Left 1075401472 10:122164070-122164092 CCTAATGCCTGTGCAACCTGGAG No data
Right 1075401478 10:122164086-122164108 CCTGGAGCCCAGGCTGGCCTGGG No data
1075401472_1075401479 -6 Left 1075401472 10:122164070-122164092 CCTAATGCCTGTGCAACCTGGAG No data
Right 1075401479 10:122164087-122164109 CTGGAGCCCAGGCTGGCCTGGGG No data
1075401472_1075401485 25 Left 1075401472 10:122164070-122164092 CCTAATGCCTGTGCAACCTGGAG No data
Right 1075401485 10:122164118-122164140 AGCCTTGGAAAGCTTTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075401472 Original CRISPR CTCCAGGTTGCACAGGCATT AGG (reversed) Intronic