ID: 1075405016

View in Genome Browser
Species Human (GRCh38)
Location 10:122189114-122189136
Sequence CAGACCGGTCATTTTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075405016_1075405024 30 Left 1075405016 10:122189114-122189136 CCTTAAAAAAAATGACCGGTCTG 0: 1
1: 1
2: 0
3: 16
4: 108
Right 1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG No data
1075405016_1075405022 26 Left 1075405016 10:122189114-122189136 CCTTAAAAAAAATGACCGGTCTG 0: 1
1: 1
2: 0
3: 16
4: 108
Right 1075405022 10:122189163-122189185 GTGTGTGTGTGCAGAGATTGGGG No data
1075405016_1075405021 25 Left 1075405016 10:122189114-122189136 CCTTAAAAAAAATGACCGGTCTG 0: 1
1: 1
2: 0
3: 16
4: 108
Right 1075405021 10:122189162-122189184 TGTGTGTGTGTGCAGAGATTGGG No data
1075405016_1075405018 2 Left 1075405016 10:122189114-122189136 CCTTAAAAAAAATGACCGGTCTG 0: 1
1: 1
2: 0
3: 16
4: 108
Right 1075405018 10:122189139-122189161 CATACTGTTTTATGCCAGCGAGG No data
1075405016_1075405020 24 Left 1075405016 10:122189114-122189136 CCTTAAAAAAAATGACCGGTCTG 0: 1
1: 1
2: 0
3: 16
4: 108
Right 1075405020 10:122189161-122189183 GTGTGTGTGTGTGCAGAGATTGG 0: 3
1: 52
2: 227
3: 851
4: 3193
1075405016_1075405023 29 Left 1075405016 10:122189114-122189136 CCTTAAAAAAAATGACCGGTCTG 0: 1
1: 1
2: 0
3: 16
4: 108
Right 1075405023 10:122189166-122189188 TGTGTGTGCAGAGATTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075405016 Original CRISPR CAGACCGGTCATTTTTTTTA AGG (reversed) Intronic
903857473 1:26345469-26345491 CGGGCCCGTCCTTTTTTTTAGGG + Exonic
908989106 1:70063278-70063300 AAGAACAGTCATTTGTTTTAAGG - Intronic
909663086 1:78105585-78105607 CAGAACCGTAATGTTTTTTAAGG + Intronic
910627464 1:89323389-89323411 CACACAGCTCATTTTCTTTAAGG + Intergenic
912878623 1:113387980-113388002 CAGAACACTCATTTTGTTTAGGG + Intergenic
920392677 1:205619579-205619601 CACACCAGTCATTTTTCTTATGG + Intronic
923003974 1:230030369-230030391 CAGAACAGTCAGTTTTTGTAAGG + Intergenic
1063273334 10:4536576-4536598 CAGGCCAGTCATTTTTTTATTGG + Intergenic
1067124901 10:43507710-43507732 CAGGAAGGTCATTTTGTTTATGG - Intergenic
1074377884 10:112953206-112953228 TAGACCGGTCATTTTTTTTATGG + Intronic
1075405016 10:122189114-122189136 CAGACCGGTCATTTTTTTTAAGG - Intronic
1078741206 11:14067792-14067814 CAGAGCTGTCATTTTGTTTGGGG - Intronic
1079067438 11:17308024-17308046 CTGTCTGGTCATTTTTTTTAGGG + Intronic
1080088991 11:28321319-28321341 CAGATCATTCACTTTTTTTATGG - Intronic
1080854137 11:36097113-36097135 CAGATCTGTCATTTCTTTTGAGG + Intronic
1085660188 11:78357322-78357344 AAGACAGGTCAGTTTTTTTATGG - Intronic
1089736909 11:120555933-120555955 CAGACAGGTCATATTTCTAATGG + Intronic
1090127727 11:124105700-124105722 GAGCCCAGTCATTTCTTTTAAGG - Intergenic
1097815970 12:64073774-64073796 CAGTCAGGTTTTTTTTTTTATGG - Intronic
1099789058 12:87307091-87307113 CATACTTGTAATTTTTTTTATGG + Intergenic
1100764875 12:97852731-97852753 CAGAACAGTTATTTTTTTGAAGG - Intergenic
1100923601 12:99518165-99518187 CTGACCAGTATTTTTTTTTATGG + Intronic
1104410966 12:128557410-128557432 CAGACCAGTAATTAGTTTTAGGG + Intronic
1105842013 13:24261771-24261793 GAAACCGGTTTTTTTTTTTAAGG - Intronic
1106205580 13:27590524-27590546 CAGCCCGGTTTTTTTTTTTAAGG + Intronic
1106666927 13:31861112-31861134 CAGACCAGTCATTTTTACAAAGG - Intergenic
1108314253 13:49221879-49221901 CAGCCTGGTCATTTTTTCTGGGG + Intronic
1108875973 13:55051500-55051522 AACACCGTTCATTGTTTTTAGGG + Intergenic
1109445934 13:62440654-62440676 CAGACCGGTTATTATATTTAGGG - Intergenic
1111477980 13:88779057-88779079 CAGAGGGGACATATTTTTTAGGG - Intergenic
1112307543 13:98288696-98288718 CAGACGGATCATTGTTTTGATGG + Intronic
1113393142 13:109916933-109916955 CAGAAAAGTCATATTTTTTATGG - Intergenic
1114435163 14:22700089-22700111 CAGACCATTCATTGTTTTTAGGG - Intergenic
1121063788 14:90941474-90941496 CATACCTGTCATTTTCTGTATGG + Intronic
1123956133 15:25336412-25336434 CAGAATGGTCATGTTTTTAATGG + Intronic
1124929485 15:34105314-34105336 CAGTCCTTTCATTTTCTTTATGG + Exonic
1125196100 15:37047644-37047666 CACAACGGTCATGGTTTTTATGG + Intronic
1125410355 15:39399843-39399865 CAGAACAGTCAGTTTTTGTAAGG + Intergenic
1131720546 15:95163735-95163757 CTGACTGGTCATTTTTTGAAAGG + Intergenic
1133126454 16:3649996-3650018 CAGGCGGGTCATTTTATTTAAGG - Intronic
1137777695 16:51070284-51070306 CAGAGCGGTGATTTTCTTTTGGG - Intergenic
1140245874 16:73248897-73248919 CAGACTGGACAGTTTTTTTAGGG - Intergenic
1140801055 16:78488698-78488720 CAGACCTGGAATTTTCTTTATGG + Intronic
1143052088 17:4134667-4134689 CAGAGAGGTTATTTTTTTTAAGG + Intronic
1146588906 17:34110644-34110666 CTAACCGATGATTTTTTTTAAGG - Intronic
1146738661 17:35261974-35261996 CAGCCCAATCATTTTTTTGATGG + Intronic
1153534962 18:6091713-6091735 GAGAGCAATCATTTTTTTTAAGG + Intronic
1153581362 18:6577215-6577237 CACAGCAGTCATTTTTTGTAAGG + Intronic
1154260567 18:12828728-12828750 TGGACTGGTCATTGTTTTTAGGG - Intronic
1159073376 18:63651373-63651395 CAGAACTGTCTTTTTTTTTATGG + Intronic
1164760001 19:30721510-30721532 CTGGCCTGTCATTCTTTTTATGG + Intergenic
1166583835 19:43927875-43927897 CAGCCAGGACATCTTTTTTATGG - Intronic
927310763 2:21628612-21628634 CAGACATGTCATCTTTTCTAGGG + Intergenic
930408331 2:50991108-50991130 CAGACCTGCCATTTATTTGAGGG - Intronic
931723821 2:65089367-65089389 CACACCTGTCTTTTTTTTTTTGG + Intronic
933855840 2:86413374-86413396 CAGACTGGTCAATTTTCCTAAGG - Intergenic
935298179 2:101668902-101668924 TAAACCTGTCATTTTTTTTCAGG + Intergenic
936623758 2:114126486-114126508 CAGACCTTTTATTTTTTTTTTGG + Intergenic
939634280 2:144562276-144562298 CTTACCGCTCATTTTCTTTAGGG - Intergenic
942253885 2:174072383-174072405 AAGAACGGTCAGTTTTTATAAGG + Intergenic
942563199 2:177242282-177242304 TAGGCCAGTTATTTTTTTTAAGG - Intronic
946803936 2:223451219-223451241 CAGGTTGCTCATTTTTTTTAAGG + Intergenic
947423348 2:229960468-229960490 CATGCCGGTCTTTTTTTTTTGGG + Intronic
1170266648 20:14473473-14473495 CAGAACTGTCTTGTTTTTTAAGG + Intronic
1173829948 20:46076507-46076529 TAAACCTGTCTTTTTTTTTAAGG + Intronic
1176415722 21:6473663-6473685 CAGGCTGGTCTTTTTTTTTTTGG + Intergenic
1177203530 21:17984645-17984667 CATACCAGTCTTTTTCTTTATGG + Intronic
1177573310 21:22918393-22918415 CAGGCAGGTCAATTTTGTTAAGG - Intergenic
1177870717 21:26569918-26569940 CACACTGGTCATTGTTTTTATGG + Intronic
1178445140 21:32633057-32633079 CAGGAGGGTCAATTTTTTTATGG - Intronic
1179691222 21:43081997-43082019 CAGGCTGGTCTTTTTTTTTTTGG + Intergenic
958043682 3:88256941-88256963 CAGAAAGGTCATTTTTTTGAAGG - Intergenic
959952608 3:112196863-112196885 TAGACCTGCCATCTTTTTTAGGG + Intronic
962392887 3:134987934-134987956 CAGACTGGTATTTTTTTTAATGG + Intronic
964667241 3:159188006-159188028 CAGAGAGGTGATTTTTTTAAAGG + Intronic
969757822 4:9161543-9161565 CAGAACTGTTTTTTTTTTTAAGG + Intergenic
970198999 4:13582905-13582927 CAGAATGTTTATTTTTTTTATGG - Intronic
975226539 4:71878830-71878852 CAAATTGGTCATTTTTGTTATGG - Intergenic
976586769 4:86806652-86806674 CATACTGGTCATTTGTTTTGTGG - Intronic
977912087 4:102548846-102548868 GAGACCTGTCATTGTGTTTACGG + Intronic
978043017 4:104092839-104092861 CAGACTGGCCAGTTTTTGTAGGG - Intergenic
979327657 4:119398290-119398312 CTGACAGGTCATTTTGTTTATGG - Intergenic
979885138 4:126017876-126017898 CAAAATGGTCATTTTTGTTAGGG - Intergenic
979937269 4:126713482-126713504 CCGGCCGGTAATTTTTTTTCTGG + Intergenic
982596168 4:157386651-157386673 CACACCGGAGATTTGTTTTATGG + Intergenic
983245406 4:165282016-165282038 CTGACAGGTCATTTTGTTTATGG - Intronic
986142341 5:5042793-5042815 CAGACTGGTCACTTTTCTCAAGG - Intergenic
987099060 5:14576789-14576811 CTGGGCGGTGATTTTTTTTAGGG - Intergenic
987374929 5:17225267-17225289 CAGACTGGTTTTTTTTTTAATGG - Intronic
987628651 5:20437640-20437662 CAGAACGTTCATTTATTTTAAGG - Intronic
987719999 5:21621078-21621100 CAAACCAGTCATTTTATTTTAGG - Intergenic
988653288 5:33177882-33177904 GGAACCAGTCATTTTTTTTAAGG + Intergenic
992664008 5:78988059-78988081 CAGAACGCTTATTCTTTTTAGGG + Intergenic
993425127 5:87753878-87753900 CAGAAATGTCATTGTTTTTAAGG - Intergenic
993479455 5:88406026-88406048 CACACCAGTCATTTATTTTTTGG - Intergenic
993568790 5:89509891-89509913 CAGACCAGTCATTCATTTCAGGG + Intergenic
999789282 5:154923380-154923402 CAGAGCTGTCCTTTTTTTTTTGG - Intronic
1000210516 5:159103131-159103153 CAGAGCAGTAGTTTTTTTTATGG + Intergenic
1003149832 6:3539155-3539177 AACACGGCTCATTTTTTTTAAGG - Intergenic
1011161123 6:84391404-84391426 CAGACTGGTCAGTTTGTTTATGG + Intergenic
1011164515 6:84431253-84431275 CATACCGGTAATTTTATTTCTGG + Intergenic
1011687849 6:89838067-89838089 CAGGCCGATTTTTTTTTTTAAGG + Intronic
1012937806 6:105386639-105386661 AATACCTTTCATTTTTTTTAGGG - Intronic
1023599688 7:41869389-41869411 CACAATGGTCATTTTTTGTAGGG - Intergenic
1027277025 7:76567578-76567600 CAGTCTGGGAATTTTTTTTATGG - Intergenic
1028894779 7:96028915-96028937 CACACCTGTCATTCTTTTAAAGG - Intronic
1029325677 7:99806853-99806875 CAGACTTGTCTTTCTTTTTAAGG - Intergenic
1031171215 7:118294274-118294296 CTGACAGGTGATTTTTCTTAAGG - Intergenic
1031600728 7:123705209-123705231 CAGACAGGACATGTTTTTGAAGG + Intronic
1032236516 7:130128987-130129009 CAGATCGTCCATTTTTTTCAAGG - Intronic
1036072268 8:5454202-5454224 CAGACACGTCATTTATTTCAGGG + Intergenic
1038146578 8:24902564-24902586 CAGACAGCTTATTTTTTTTTTGG - Intergenic
1041730900 8:61061676-61061698 TAAACCGGTTATCTTTTTTACGG + Intronic
1042880621 8:73484706-73484728 CAGGCTGGTCATTTCTTCTAGGG - Intronic
1044318596 8:90777166-90777188 CAAACCAGCAATTTTTTTTAAGG + Intronic
1047533310 8:125696835-125696857 CAGACCTTTCATTCTTTGTAAGG + Intergenic
1055386220 9:75764995-75765017 CAGACCGGAAAGTTTTTTTGAGG + Intergenic
1059106207 9:111513801-111513823 CATACTCGTCATTTTTTTCAAGG - Intergenic
1059777984 9:117495351-117495373 TAGACCAGTAACTTTTTTTAAGG - Intergenic
1186321886 X:8436602-8436624 CAGACATGCCATTGTTTTTATGG - Intergenic
1189334769 X:40164420-40164442 CAGGCAGGAAATTTTTTTTAAGG + Intronic
1190638178 X:52456958-52456980 CACACCTGTACTTTTTTTTAAGG - Intergenic
1190678480 X:52803491-52803513 CACACCTGTACTTTTTTTTAAGG + Intergenic
1194088709 X:89560127-89560149 GGGAGAGGTCATTTTTTTTATGG - Intergenic
1196055465 X:111350454-111350476 CAAACAGGTAATTTATTTTATGG + Intronic
1200441386 Y:3216180-3216202 GGGAGAGGTCATTTTTTTTATGG - Intergenic