ID: 1075405017

View in Genome Browser
Species Human (GRCh38)
Location 10:122189129-122189151
Sequence ATAAAACAGTATGATCAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 239}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075405017_1075405023 14 Left 1075405017 10:122189129-122189151 CCGGTCTGATCATACTGTTTTAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1075405023 10:122189166-122189188 TGTGTGTGCAGAGATTGGGGAGG No data
1075405017_1075405026 30 Left 1075405017 10:122189129-122189151 CCGGTCTGATCATACTGTTTTAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1075405026 10:122189182-122189204 GGGGAGGGGAAAGCTTTTATTGG No data
1075405017_1075405024 15 Left 1075405017 10:122189129-122189151 CCGGTCTGATCATACTGTTTTAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG No data
1075405017_1075405022 11 Left 1075405017 10:122189129-122189151 CCGGTCTGATCATACTGTTTTAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1075405022 10:122189163-122189185 GTGTGTGTGTGCAGAGATTGGGG No data
1075405017_1075405021 10 Left 1075405017 10:122189129-122189151 CCGGTCTGATCATACTGTTTTAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1075405021 10:122189162-122189184 TGTGTGTGTGTGCAGAGATTGGG No data
1075405017_1075405025 16 Left 1075405017 10:122189129-122189151 CCGGTCTGATCATACTGTTTTAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1075405025 10:122189168-122189190 TGTGTGCAGAGATTGGGGAGGGG No data
1075405017_1075405020 9 Left 1075405017 10:122189129-122189151 CCGGTCTGATCATACTGTTTTAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1075405020 10:122189161-122189183 GTGTGTGTGTGTGCAGAGATTGG 0: 3
1: 52
2: 227
3: 851
4: 3193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075405017 Original CRISPR ATAAAACAGTATGATCAGAC CGG (reversed) Intronic
905063982 1:35164168-35164190 ACAAAACAGAATAATCAGCCAGG + Intergenic
906977085 1:50587443-50587465 ATAAAAAAATATGAAGAGACTGG - Intronic
907061220 1:51427682-51427704 ATCACACAGTATTCTCAGACTGG - Intronic
907774249 1:57497936-57497958 AGAAATCAGAATGATCAGTCAGG + Intronic
908625270 1:66033296-66033318 ATAAAACAATATGAACAGAATGG + Intronic
909405570 1:75284858-75284880 ATAATACATTATGATCAAATGGG - Intronic
909496430 1:76284212-76284234 ATAACACAGAAGGATCAGAGAGG + Intronic
910134809 1:83955380-83955402 ATGAAACAGTATGATGAGGTAGG + Intronic
910970592 1:92851924-92851946 ATGAAATAGTAAGATAAGACAGG + Intronic
911631059 1:100183845-100183867 ATCAAACAGCATGATAAGGCTGG - Intergenic
911890074 1:103357300-103357322 ATAATACACTATAATCAGGCAGG + Intergenic
913167781 1:116204610-116204632 ATAAAACAAAATGAGAAGACTGG + Intergenic
914856865 1:151358624-151358646 ATAAAACAAGATGATCGGCCAGG - Intergenic
916277224 1:163008006-163008028 CTAAAACTATATGATCAGATTGG + Intergenic
918742388 1:188150123-188150145 GTAAAACAGTTTGAATAGACAGG + Intergenic
919754889 1:201060619-201060641 AGAAAAATGTCTGATCAGACTGG - Intronic
922061631 1:222097987-222098009 ATATAAGAGTATAAACAGACAGG - Intergenic
923661357 1:235960006-235960028 ATAAAACAGAAGGAACAGACAGG - Intergenic
924207420 1:241727716-241727738 AGAAAACAGTATGATAAGTATGG + Intronic
1064852161 10:19720793-19720815 AAAAAACAGTCTGTTCAAACAGG + Intronic
1065166291 10:22981843-22981865 ATGAAACAGAATCATCAGATGGG + Intronic
1065402375 10:25320060-25320082 ATAAAACAGTGTGACTCGACGGG - Intronic
1065432221 10:25671113-25671135 ATGAAACATTATGCACAGACAGG + Intergenic
1066621378 10:37354938-37354960 ATAATACAGTATGATCAAGTGGG - Intronic
1067915635 10:50395120-50395142 CAAAATCAGTATGATCAGAGAGG - Intronic
1068569363 10:58611784-58611806 ATAAAACAGAATGTACAGGCTGG - Intronic
1068970035 10:62949301-62949323 ATAAAACAGTATGTTTTGGCTGG + Intergenic
1069740617 10:70684894-70684916 GTAAAACTGCAAGATCAGACTGG - Intronic
1073015620 10:100396836-100396858 ATTTAACAGAATGATCAGGCTGG + Intergenic
1075405017 10:122189129-122189151 ATAAAACAGTATGATCAGACCGG - Intronic
1085632073 11:78126664-78126686 ACAAAACATTAGGAACAGACAGG + Intronic
1086179896 11:83938153-83938175 ATAAAACATTTTAATGAGACAGG + Intronic
1086306977 11:85491064-85491086 ATAATACATTATGATCAAATGGG + Intronic
1087147468 11:94826351-94826373 ATAAAAAAGTATGATTACAGAGG - Intronic
1088233423 11:107697410-107697432 ATAGAACAGTAAGATTAGGCTGG + Intergenic
1091930826 12:4393995-4394017 ATAAAACAGATTTATCAGCCAGG - Intergenic
1093815026 12:23535082-23535104 ATAAAACAGTAGTAACAAACAGG - Intronic
1094242124 12:28240952-28240974 GTAAAACAGTATGATCACTTGGG - Intronic
1094778587 12:33762747-33762769 ATAATACATTATGATCAAATTGG + Intergenic
1096183199 12:49562334-49562356 AGAAAACAGTGTGATTAAACTGG - Intronic
1100439049 12:94598768-94598790 ACAAAACAGTATGATCTTAGAGG - Intronic
1100629977 12:96378438-96378460 ATAAAACTGTAAGATCAACCTGG - Intronic
1100963796 12:99990881-99990903 ATAAAACAGAGTGATGAGAATGG + Intergenic
1103435434 12:120921798-120921820 AGAAAACAGTAGGCTCAGAGAGG - Intergenic
1105030187 12:132877089-132877111 AAAAAACATTATTATCAGCCCGG - Intronic
1105654580 13:22422229-22422251 ATAAAACAAAAAGATGAGACTGG + Intergenic
1105887217 13:24652314-24652336 AGCAAACAGTAGGACCAGACAGG + Intergenic
1106869995 13:34009024-34009046 ATAAAACAGTCTTATCACTCAGG - Intergenic
1106922345 13:34577030-34577052 ATTAAAAAGTATTATCAGGCTGG + Intergenic
1107194938 13:37639320-37639342 ATATAACAGTATAACCAGAAAGG - Intronic
1107573558 13:41690580-41690602 ATAAAACTCTTTGATCAGCCAGG + Intronic
1109243640 13:59925403-59925425 ATAATACAGTATGATCAAATGGG - Intronic
1109743606 13:66589411-66589433 ATAAAATAGAATGATCAGATCGG - Intronic
1111290653 13:86165837-86165859 ATAAAACAGAAAAATCAGAGAGG + Intergenic
1112061557 13:95744760-95744782 ATAAAAGAATATTATCAGGCAGG + Intronic
1112514532 13:100041571-100041593 AAATTACAGTATAATCAGACCGG + Intergenic
1112550153 13:100411850-100411872 ATATGACAGTATGAGGAGACAGG - Intronic
1116656851 14:47664988-47665010 ATAAAATTGTATGATGACACAGG + Intronic
1117806460 14:59496929-59496951 ATATAAATGTATGGTCAGACTGG + Intronic
1118560295 14:67072289-67072311 ATAAAACATTAGGAATAGACAGG - Intronic
1118724230 14:68617018-68617040 AAAAGACAGAATGAACAGACAGG - Intronic
1119298735 14:73553525-73553547 ATAAAAAAGTATTATCACATTGG + Intronic
1119934710 14:78580951-78580973 GTAGAACAGTATGATGTGACAGG - Intronic
1120536867 14:85707157-85707179 ATAAAAAAATTTGATCTGACTGG - Intergenic
1120763281 14:88305403-88305425 ACAAAATAGTTTGATGAGACTGG + Intronic
1121377391 14:93425501-93425523 TTAAAACAGTATGGTTAAACAGG + Intronic
1122710916 14:103657244-103657266 ATAATACAGTTTCATCAGAAGGG + Intronic
1124997907 15:34741729-34741751 ACAAAACAGTATGTACAGAGAGG + Intergenic
1126489644 15:49222741-49222763 ATAAAACACCATGATCAAGCGGG - Intronic
1127507779 15:59611541-59611563 AGAAACCAGTTTGATCACACTGG + Intronic
1128011135 15:64297210-64297232 ATAAAGCAGTTTGACGAGACAGG + Intronic
1129927507 15:79377939-79377961 ATAGAACAGTTTGTTCAGCCGGG - Intronic
1130721587 15:86391604-86391626 ATACAAAGGTATGATCAGACGGG - Intronic
1131543430 15:93295036-93295058 ATAAACAAGGATCATCAGACAGG + Intergenic
1135726247 16:24856005-24856027 AGAAAGTGGTATGATCAGACAGG - Intronic
1137700176 16:50491858-50491880 GTGAATCAGTATGATCAGACTGG - Intergenic
1139171365 16:64633764-64633786 GTATATCAGTATGATGAGACTGG - Intergenic
1140320733 16:73949329-73949351 ATCAATCAGGATGATCAGAAAGG + Intergenic
1140498819 16:75414704-75414726 ACATAACAGGGTGATCAGACAGG + Intronic
1140530811 16:75664328-75664350 ATAAAACTGTATCTTCAGCCGGG + Intronic
1140610202 16:76589501-76589523 CTAAAATAGTATGATCAGTTTGG + Intronic
1140645582 16:77026436-77026458 ATGAAACATTTTGATCACACAGG + Intergenic
1143337649 17:6185329-6185351 CAAAAACAGCATGTTCAGACTGG + Intergenic
1147011157 17:37449315-37449337 ATAAAACAGTGAAATCAGGCCGG - Intronic
1154417556 18:14189924-14189946 AAACAACAGAATGATCAGAATGG - Intergenic
1156082702 18:33357367-33357389 ATAAAACAATATGAATAGATAGG - Intronic
1156313195 18:35943412-35943434 TTAAAACAATATGAACAGATGGG + Intergenic
1157375051 18:47155167-47155189 ATAAAACTGTATTATGAGATAGG + Intronic
1158366904 18:56746616-56746638 ATAATACAGCCAGATCAGACAGG + Intronic
1159899369 18:74029802-74029824 ATAAAACAGTAAGGGAAGACGGG + Intergenic
1160320835 18:77893275-77893297 ATAAAGCAGTATAATAATACCGG - Intergenic
1164783758 19:30913345-30913367 ATAAAACAGGGTGATCAGGATGG + Intergenic
1165454574 19:35903284-35903306 ACAAAACAGAATGCTCAGCCTGG - Intronic
1166583168 19:43920900-43920922 TTAAAACAGTATGATAATGCTGG - Intronic
1166936576 19:46337102-46337124 TTTAAACAGTATGATCAGGGTGG + Intronic
1168148399 19:54431921-54431943 ATAAAACAGTAGGAGCTGGCCGG + Intronic
1168150236 19:54443019-54443041 ATAGAACAGTATCATAAGGCTGG + Intergenic
926174831 2:10581528-10581550 TTAAAACAGTATAATTAGGCTGG + Intronic
926432095 2:12798262-12798284 ATAAAATATTATGAGCAGAAAGG - Intergenic
930886596 2:56333448-56333470 AGAAAACAGTCAGATCACACAGG + Intronic
932995946 2:76852947-76852969 AAAAAACAGTATATTCAAACAGG + Intronic
934499678 2:94847389-94847411 AAACAACAGAATGATCAGAATGG + Intergenic
937409196 2:121658121-121658143 AAAAAACAGTATTATGAGACAGG - Intergenic
937883443 2:126885041-126885063 ATGAAAAATTAGGATCAGACTGG + Intergenic
939120509 2:138110580-138110602 ATTAAACAGAATGACCAGTCTGG - Intergenic
939972774 2:148680873-148680895 ATAAAACAGTATGCTGTTACTGG + Intronic
940020118 2:149147451-149147473 ATCACACAGTATGATCTGACTGG - Intronic
940528358 2:154845614-154845636 AGAAAAAAGTTTGATGAGACTGG + Intronic
941308580 2:163901003-163901025 ATAACACACTATGAACAAACGGG + Intergenic
942044565 2:172092441-172092463 ATAAAACATAATGATCAGAGAGG - Intergenic
943443928 2:187959261-187959283 ATAAATCAGAATGATCAGAAAGG - Intergenic
946500277 2:220239942-220239964 TTAAAACAGAAGGATCAGGCTGG - Intergenic
946649724 2:221878330-221878352 TTAATACAGTGTGATCAAACAGG - Intergenic
946707632 2:222474023-222474045 ATAACACATAATGATCAGTCAGG - Intronic
1170330088 20:15199715-15199737 TTAAAACAGCATGAACAAACTGG - Intronic
1170831654 20:19847759-19847781 ATTAAAAAGTAAGATTAGACAGG - Intergenic
1171198262 20:23219491-23219513 ATAATACAGTATGATCAAGTGGG - Intergenic
1172717983 20:36977943-36977965 ATAAAAATGTATGATCAGGCCGG - Intergenic
1173879586 20:46401895-46401917 ATAAATCAGTAGGATCAGGAAGG - Intronic
1174620635 20:51871923-51871945 ATAAACCAGTTTGACCAGAATGG - Intergenic
1175409743 20:58759202-58759224 GTAAAACAGAATCATCAGAGTGG + Intergenic
1175522764 20:59612677-59612699 TTAAAACAGGATGGTCAGCCAGG - Intronic
1175709778 20:61210254-61210276 GGAAAGGAGTATGATCAGACGGG - Intergenic
1176165527 20:63671352-63671374 ATAAAACAGTAGGTCCAGCCGGG - Intronic
1176855753 21:13969345-13969367 AAACAACAGAATGATCAGAATGG + Intergenic
1177091174 21:16770529-16770551 ATAAACCACTAAAATCAGACTGG + Intergenic
1177363896 21:20108924-20108946 ATGAAAGAGAATGATCAGAGTGG + Intergenic
1180822591 22:18840963-18840985 TTAAAACGTTATGCTCAGACGGG + Intergenic
1180886567 22:19249052-19249074 ATACAACACTTTGATTAGACTGG + Intronic
1181190372 22:21135064-21135086 TTAAAACGTTATGCTCAGACGGG - Intergenic
1181208830 22:21275459-21275481 TTAAAACGTTATGCTCAGACGGG + Intergenic
1183636774 22:39068537-39068559 TTAAAACAGAATCATAAGACCGG + Intronic
1183637741 22:39074976-39074998 TTAAAACAGAATCATAAGACGGG + Intronic
1184542364 22:45135154-45135176 AGAAAACAGAATGACAAGACAGG + Intergenic
1203218109 22_KI270731v1_random:19987-20009 TTAAAACGTTATGCTCAGACGGG - Intergenic
1203272729 22_KI270734v1_random:66868-66890 TTAAAACGTTATGCTCAGACGGG + Intergenic
950037922 3:9900469-9900491 ACAAAACAGTAAGATCTGAAAGG - Intergenic
953659217 3:44879173-44879195 ATAAATCAGAATGATGAGAAAGG - Intronic
955864994 3:63372612-63372634 ATTAATCAGTGTGATCAGCCTGG - Intronic
956403398 3:68903764-68903786 TTAAAACATTATTATGAGACAGG + Intronic
957288080 3:78242373-78242395 AGAAATCAGTATAATAAGACAGG + Intergenic
957470997 3:80657221-80657243 ATAAAGGAGTAGGAGCAGACAGG - Intergenic
957902813 3:86518550-86518572 ATAAAGCAATATTAGCAGACTGG - Intergenic
960013958 3:112864560-112864582 ATAATACACTATGATCAGGTGGG - Intergenic
960446753 3:117758728-117758750 ATAAATCAGTATGACAAGGCTGG + Intergenic
960759533 3:121057895-121057917 AGAAAACAATATGATGAGTCAGG - Intronic
961317687 3:126051739-126051761 ATAAATCAGTAGGATCAGGTGGG - Intronic
962101634 3:132348831-132348853 ATAAAATAGTAAGAAGAGACAGG - Intronic
964719772 3:159759868-159759890 ATCAAAGAGTATGAATAGACAGG - Intronic
964786004 3:160397526-160397548 CATAAACAGTATGATGAGACAGG + Intronic
964795251 3:160489800-160489822 ATAGAACTGTATGATAAGAAGGG - Intergenic
965871734 3:173273513-173273535 ATAACACACTATGATCAGCTGGG - Intergenic
965970394 3:174547616-174547638 ATAAAACAGAATGCTGAGAAAGG - Intronic
967351806 3:188522152-188522174 CTTAAACAGTTTAATCAGACTGG + Intronic
970903344 4:21185896-21185918 ATAAAGCAGTTTGTTAAGACAGG - Intronic
971443877 4:26721222-26721244 ATAAAACAGTGAGTTCAGGCTGG - Intronic
971587905 4:28429109-28429131 ATAATACACTATGATCAAACAGG - Intergenic
973090681 4:46132541-46132563 AGGAAATAGTATGATCAAACTGG + Intergenic
973746232 4:53965975-53965997 AGAAAACAGTATGAGCATTCAGG + Intronic
974239702 4:59230665-59230687 ATAACACATTATGATCAGGTAGG + Intergenic
974755540 4:66202243-66202265 TTAAAACAGATTGATCAGGCAGG + Intergenic
976425953 4:84903614-84903636 TTAAAACAGTATTATAGGACTGG - Intronic
976627066 4:87197267-87197289 AGAATACAGTATGAGCAGACTGG + Intronic
978276678 4:106958993-106959015 ATAAAACAAAATGATAAGAAAGG + Intronic
978286738 4:107086832-107086854 ATAAAACATCATTATCAAACAGG - Intronic
979076134 4:116273797-116273819 ATAAATGAATATGAGCAGACTGG - Intergenic
979399311 4:120228627-120228649 ATAAAACAGGATGGTCAGATAGG - Intergenic
979498133 4:121408023-121408045 ATAACACACCATGATCAGATGGG - Intergenic
980650460 4:135707592-135707614 ATAAAACAGTATGGAAATACAGG - Intergenic
980684876 4:136214332-136214354 ATAATACACTATGATCAAATGGG - Intergenic
981592064 4:146375252-146375274 ACCAAACAGTATGAATAGACAGG + Intronic
982563704 4:156962961-156962983 ATAAACCAGCATGATCTGCCAGG - Intronic
982796175 4:159647793-159647815 ATAAAACAGTAGGAGGAGAAAGG - Intergenic
984291313 4:177798375-177798397 ATAAAAGAGGATGATCTGAGTGG - Intronic
984837678 4:184037134-184037156 ATAAAACAGTATTATGATAGGGG + Intergenic
984853022 4:184169861-184169883 ACAAAACAGTGTGATAACACGGG + Intronic
987575119 5:19716777-19716799 TAAAAATAGTAAGATCAGACAGG - Intronic
990085828 5:51975502-51975524 AAAAAAAAGAATGATCACACAGG - Intergenic
990300488 5:54444920-54444942 CTAATAAAGTTTGATCAGACTGG + Intergenic
990990697 5:61680861-61680883 CTAAATCAGTATGATCACAGTGG - Intronic
991910466 5:71555399-71555421 TTCAAACAGTATGATGATACTGG - Intronic
992973032 5:82082243-82082265 ATAAAAGGGTAAAATCAGACTGG + Intronic
993180657 5:84547937-84547959 ATAAAACAAAAATATCAGACTGG - Intergenic
993186156 5:84622798-84622820 ATAAAATAGAATGCACAGACTGG - Intergenic
994024401 5:95065404-95065426 ATAAAACAGTATGACCAATATGG + Intronic
994416097 5:99473729-99473751 AAGAAACAGTATGATCTGAAAGG + Intergenic
994463872 5:100101443-100101465 AAGAAACAGTATGATCTGAAAGG - Intergenic
994572656 5:101534314-101534336 AAAAAAGAGTATGACCTGACAGG - Intergenic
996553209 5:124751240-124751262 ATAAACCAGTGTTGTCAGACTGG + Intergenic
996653005 5:125904407-125904429 ACAAAAGGGTATGATCTGACAGG + Intergenic
997987343 5:138513212-138513234 AGAAAACAGTATGATGTGAGGGG - Intronic
998516546 5:142760373-142760395 TTAAAACAATGTGATCAAACTGG + Intergenic
1001342931 5:170863380-170863402 ATAAATCAGTGTGATCACAGGGG - Intronic
1006548001 6:34795372-34795394 AAAAAACTGTATGTTCAGGCTGG - Intronic
1008574229 6:52844259-52844281 ATAAAACAACATAATCAGACAGG - Intronic
1009525253 6:64735866-64735888 ATAAAGAACTATGATCACACTGG + Intronic
1010419210 6:75652824-75652846 GAAAAACATTTTGATCAGACTGG - Intronic
1010599827 6:77810443-77810465 ATTTAAGAGTATGATCATACAGG + Intronic
1011602181 6:89070022-89070044 CTAAACCAGGATAATCAGACGGG + Intergenic
1011659954 6:89586158-89586180 ATAATACAGTGTGATCAGGTGGG + Intronic
1013957755 6:115860384-115860406 ATAAAGCAGAATGAGAAGACAGG - Intergenic
1014301563 6:119688697-119688719 ATAAAACTGAATGATCAGATGGG + Intergenic
1015645175 6:135379710-135379732 AGAAAACAGTAAGTTCAGAGAGG - Intronic
1017206846 6:151811714-151811736 ATAAAAAAGTAAGATCAGAAAGG - Intronic
1019903252 7:4041141-4041163 ATAAAACAGCTTGATAAGAGGGG + Intronic
1020888010 7:13843652-13843674 ATAAATTAGTATGATCCAACTGG - Intergenic
1021022738 7:15623981-15624003 ATAAAACAGAATTATCACCCAGG - Intronic
1022238580 7:28487370-28487392 AAAAAACCTTATAATCAGACAGG - Intronic
1022414482 7:30166389-30166411 ATAAAACAGGATCCTCAGATGGG + Intergenic
1022788970 7:33667755-33667777 ATAAAAAACTCTGATCACACAGG - Intergenic
1026762754 7:73138780-73138802 ATTAAACAGTGTGTTCAGGCCGG + Intergenic
1027039218 7:74948568-74948590 ATTAAACAGTGTGTTCAGGCCGG + Intergenic
1027084424 7:75253812-75253834 ATTAAACAGTGTGTTCAGGCCGG - Intergenic
1029033480 7:97493259-97493281 AAAAAATAGTATGATAAGAAAGG + Intergenic
1029428758 7:100515451-100515473 AAAAAAAAGTATGATCAACCAGG - Intergenic
1029700743 7:102245338-102245360 ATAAAACTGTCTGCTCAGGCCGG - Intronic
1030011762 7:105176117-105176139 ATAAAACATCATGATCAAATGGG + Intronic
1031707757 7:125003129-125003151 AAAAAACAGTGTGATGAAACTGG + Intergenic
1031760420 7:125706826-125706848 ATTAAACAGAATAATCTGACTGG + Intergenic
1032491090 7:132325081-132325103 ATAAACCAGTATGAGGAGCCCGG - Intronic
1032779620 7:135153690-135153712 ATAATACACTATGATCAGATGGG - Intronic
1032866975 7:135935598-135935620 TATGAACAGTATGATCAGACTGG - Intronic
1032906528 7:136373908-136373930 TTAAAACAGGATGATCAGGGAGG + Intergenic
1035136355 7:156707511-156707533 ATAATACACCATGATCAGGCAGG + Intronic
1037212560 8:16409158-16409180 ATAAAACAATTTGGTAAGACTGG + Intronic
1037358269 8:18046060-18046082 ATGAAACAGTATGACCAGTTTGG - Intergenic
1039256872 8:35728780-35728802 ATAAAACAGGAAGCTCAGACTGG + Intronic
1039673374 8:39629970-39629992 ATAAAACAATGTGACCAGAAAGG - Intronic
1040475867 8:47777007-47777029 ATATACCATTATGATCAGCCGGG - Intronic
1042304743 8:67319922-67319944 ATAAAAAAAGATGCTCAGACCGG + Intronic
1042693247 8:71527370-71527392 TTAACACAGTATGATTCGACTGG - Intronic
1044172830 8:89077190-89077212 ATAAAACTGTATGATGTGATAGG + Intergenic
1044174082 8:89095315-89095337 ATAGATCAATATGATCAGATAGG - Intergenic
1044511753 8:93089304-93089326 ATGAAACAAGATGATGAGACGGG + Intergenic
1045138030 8:99245165-99245187 ATCACACAGTATTATCAAACTGG - Intronic
1045646088 8:104300388-104300410 ATAATAAAACATGATCAGACCGG + Intergenic
1050558772 9:6812379-6812401 AAAACACAGAATGATCAGAAAGG - Intronic
1050743650 9:8851696-8851718 ATAAATTTGTATGATCAAACTGG + Intronic
1051826269 9:21223722-21223744 ATAAAAAAGAATGACCAGAAGGG + Intronic
1052242758 9:26294092-26294114 ATTAGACTGTATGATAAGACTGG - Intergenic
1052322714 9:27185266-27185288 ATACAACAGCAGGATCTGACAGG + Intronic
1052444273 9:28540098-28540120 AAAAAACAGTTTGATAAGACTGG + Intronic
1053371633 9:37566296-37566318 ATAAAAAAGTAAGATTAGCCAGG + Intronic
1053427651 9:38021357-38021379 ATAAAAAAGAATGATGAGGCTGG + Intronic
1055821406 9:80268996-80269018 ACAATACTGTTTGATCAGACTGG + Intergenic
1057100013 9:92349992-92350014 ACAAAACAGTATGGTCATTCTGG - Intronic
1057107039 9:92429061-92429083 ATAAAAGAGTCTTATCAGAAAGG - Intronic
1057525103 9:95792159-95792181 ATAAAACACTAAAATCGGACCGG + Intergenic
1059770820 9:117423311-117423333 ATAAAACAGAATAATGAGAGAGG + Intergenic
1061227027 9:129286320-129286342 ATAAAACAGCAGGAAAAGACAGG - Intergenic
1187353857 X:18547728-18547750 ATTAAACTGTATTATCACACAGG - Intronic
1188599102 X:31939784-31939806 ATAAAACATTATGAGTACACAGG + Intronic
1188746638 X:33852630-33852652 ATAAAAAATTATGCTCATACTGG - Intergenic
1191153644 X:57247316-57247338 GAAAAACAGAATGATCAAACAGG + Intergenic
1193345894 X:80404157-80404179 TTAAAACAATATCATCAGAATGG + Intronic
1194284253 X:91990169-91990191 ATAAAACTGTATAATCATAATGG - Intronic
1196247031 X:113412472-113412494 ATAGAAGAGTATCATCAGATGGG + Intergenic
1196539461 X:116888606-116888628 AAAAAACAGCATGATCAAATGGG - Intergenic
1200333832 X:155326487-155326509 GTAAAATAGTATGACCACACTGG + Intronic
1200601820 Y:5214727-5214749 ATAAAACTGTATAATCATAATGG - Intronic