ID: 1075405024

View in Genome Browser
Species Human (GRCh38)
Location 10:122189167-122189189
Sequence GTGTGTGCAGAGATTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075405019_1075405024 -9 Left 1075405019 10:122189153-122189175 CCAGCGAGGTGTGTGTGTGTGCA 0: 1
1: 0
2: 5
3: 75
4: 603
Right 1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG No data
1075405017_1075405024 15 Left 1075405017 10:122189129-122189151 CCGGTCTGATCATACTGTTTTAT 0: 1
1: 0
2: 0
3: 20
4: 239
Right 1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG No data
1075405016_1075405024 30 Left 1075405016 10:122189114-122189136 CCTTAAAAAAAATGACCGGTCTG 0: 1
1: 1
2: 0
3: 16
4: 108
Right 1075405024 10:122189167-122189189 GTGTGTGCAGAGATTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075405024 Original CRISPR GTGTGTGCAGAGATTGGGGA GGG Intronic
No off target data available for this crispr