ID: 1075406973

View in Genome Browser
Species Human (GRCh38)
Location 10:122201503-122201525
Sequence CTGTGTTCATATGGGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075406963_1075406973 22 Left 1075406963 10:122201458-122201480 CCACATCTACACTGAAAGGATGG 0: 1
1: 1
2: 1
3: 32
4: 169
Right 1075406973 10:122201503-122201525 CTGTGTTCATATGGGGAGGACGG No data
1075406966_1075406973 -9 Left 1075406966 10:122201489-122201511 CCTGCCCACAGTGGCTGTGTTCA 0: 3
1: 5
2: 5
3: 35
4: 330
Right 1075406973 10:122201503-122201525 CTGTGTTCATATGGGGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075406973 Original CRISPR CTGTGTTCATATGGGGAGGA CGG Intronic
No off target data available for this crispr