ID: 1075407615

View in Genome Browser
Species Human (GRCh38)
Location 10:122205006-122205028
Sequence TGACAGAGCCATAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075407615_1075407618 -3 Left 1075407615 10:122205006-122205028 CCATCCTCACTATGGCTCTGTCA 0: 1
1: 0
2: 4
3: 26
4: 304
Right 1075407618 10:122205026-122205048 TCACTTAGATGCTCACGAGGCGG No data
1075407615_1075407617 -6 Left 1075407615 10:122205006-122205028 CCATCCTCACTATGGCTCTGTCA 0: 1
1: 0
2: 4
3: 26
4: 304
Right 1075407617 10:122205023-122205045 CTGTCACTTAGATGCTCACGAGG No data
1075407615_1075407619 7 Left 1075407615 10:122205006-122205028 CCATCCTCACTATGGCTCTGTCA 0: 1
1: 0
2: 4
3: 26
4: 304
Right 1075407619 10:122205036-122205058 GCTCACGAGGCGGACTCTGCTGG No data
1075407615_1075407620 8 Left 1075407615 10:122205006-122205028 CCATCCTCACTATGGCTCTGTCA 0: 1
1: 0
2: 4
3: 26
4: 304
Right 1075407620 10:122205037-122205059 CTCACGAGGCGGACTCTGCTGGG No data
1075407615_1075407621 18 Left 1075407615 10:122205006-122205028 CCATCCTCACTATGGCTCTGTCA 0: 1
1: 0
2: 4
3: 26
4: 304
Right 1075407621 10:122205047-122205069 GGACTCTGCTGGGAACAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075407615 Original CRISPR TGACAGAGCCATAGTGAGGA TGG (reversed) Intronic
900773730 1:4565854-4565876 TGCCAGAGCCACAGCGAGGGCGG - Intergenic
901005972 1:6171690-6171712 AGATGGAGCCATAGGGAGGAGGG - Intronic
901773227 1:11541642-11541664 TGACAGAGGCAGGGTGAGGAAGG - Intergenic
903577911 1:24350654-24350676 TGACAGAGCCGTAGGCAGGAAGG + Intronic
904279687 1:29410050-29410072 TGACATCTCCACAGTGAGGAGGG + Intergenic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905348458 1:37327821-37327843 TGCCAGAGCCAGAGGGAGGAGGG - Intergenic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
907515652 1:54991760-54991782 TGCCAGAGAGACAGTGAGGAAGG - Intronic
907758278 1:57332359-57332381 AGACTGAGGCATAGTGAGGATGG - Intronic
910159553 1:84258888-84258910 TGACAGAGCCATTGAAAGGCAGG - Intergenic
910366635 1:86472338-86472360 TGAGAGAGCTATAGGGAGGAGGG - Intronic
912045130 1:105444273-105444295 TGACAGAAACATAGTGTGCAAGG - Intergenic
913220273 1:116654512-116654534 TGTAAGAGCCATACTGATGAGGG + Intronic
913256014 1:116954245-116954267 TGGCAGAACCATTATGAGGATGG - Intronic
913422340 1:118685085-118685107 GGACAGAGCCATGTTGAGGAGGG + Intergenic
913991771 1:143619993-143620015 TAGCAGAGCCGTGGTGAGGACGG + Intergenic
915507592 1:156367457-156367479 TGAGGGAGTCATAGTGTGGAAGG - Intronic
916946109 1:169729330-169729352 TCACAGAGCCATTCTGAGGCTGG + Exonic
917457794 1:175200477-175200499 CCCCAGAGCCATACTGAGGAAGG - Intergenic
918248685 1:182682837-182682859 GGACAGAGCAAGAGTGTGGATGG - Intronic
919411258 1:197246003-197246025 TGACACTACCATAGTGGGGAGGG + Intergenic
922243731 1:223774822-223774844 AAACAGAGCCACTGTGAGGAAGG - Exonic
923086339 1:230706000-230706022 GGTCAGAGGCATAGTGAGGCTGG + Exonic
1063536683 10:6890811-6890833 TGTCAGAGCCGGAGTGAAGAGGG - Intergenic
1069230161 10:65998587-65998609 GGAAAGAGGGATAGTGAGGAGGG + Intronic
1069646751 10:70005226-70005248 AGAGAGAGCCAGAGAGAGGAAGG + Intergenic
1071516337 10:86300445-86300467 TGACAGAGCCAGAGGGAACAGGG + Intronic
1071814465 10:89218712-89218734 TGGCAGAGCTATAGTATGGAGGG + Intronic
1072269529 10:93762402-93762424 TGATAAAGCCTTAGTAAGGATGG - Intronic
1072462736 10:95634938-95634960 TGAAACAGTCAAAGTGAGGATGG + Intronic
1073680920 10:105702560-105702582 CGACAGAGCCATCATGAAGAAGG - Intergenic
1074839504 10:117335207-117335229 TGACATAGCCAAAGTGCTGAAGG + Intronic
1074885778 10:117692076-117692098 TGACTGAGGCATAGTGAGAGAGG - Intergenic
1075407615 10:122205006-122205028 TGACAGAGCCATAGTGAGGATGG - Intronic
1075947470 10:126448850-126448872 TAACAGAGTCACAGTGAGTAAGG + Intronic
1076349533 10:129806479-129806501 TGACATATCCAAAGTGAAGAGGG - Intergenic
1077192889 11:1262843-1262865 GGACAGAGCAATAGAAAGGAAGG - Intergenic
1077274866 11:1699939-1699961 TGTCAGAGCCATGGTGAGACGGG - Intergenic
1077358885 11:2131010-2131032 TGGCCCAGCCAGAGTGAGGAAGG - Intronic
1078437480 11:11337576-11337598 TGACAGAGAGATATTTAGGAGGG + Intronic
1079094337 11:17501226-17501248 TGACAGAGCCACAGTAAGAGTGG + Intronic
1080927645 11:36774742-36774764 TGACAGAGCAATAGAATGGATGG + Intergenic
1081540584 11:44031814-44031836 AGACACAGCCTTAGTGTGGATGG + Intergenic
1081567441 11:44268717-44268739 TGAGAGAGGGAGAGTGAGGAGGG + Intronic
1083547319 11:63558592-63558614 CAACAAAGCCATAGTGAAGAAGG - Exonic
1083551013 11:63590300-63590322 TGACAAGGCCATCGTGAAGAAGG - Exonic
1083625744 11:64071212-64071234 TGACAGGGTCTTAGGGAGGAAGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085707262 11:78797729-78797751 TGACAGTGGCATAGAGAGGAAGG - Intronic
1086231419 11:84574971-84574993 AGACAGAGTCATTGTGAGGAGGG - Intronic
1087284825 11:96253929-96253951 TGATAGTGCCATAATGAGAAGGG - Intronic
1088511286 11:110578319-110578341 TGAGAGAGCAATATTGAGGTTGG - Exonic
1089673300 11:120072176-120072198 TGTCAGAGGCATTGTGGGGAAGG - Intergenic
1090854040 11:130596494-130596516 TGACACAGCCTGAGTGAGGTAGG - Intergenic
1090959114 11:131540012-131540034 TGACAGGACCGTAGTGAGCAAGG - Intronic
1091366342 11:135023672-135023694 TGACAGAGTCAGAGTGGGGCGGG + Intergenic
1091560167 12:1606098-1606120 TGACTGAGCCACAGTGCGAAGGG + Intronic
1096936875 12:55289974-55289996 TGACAGAGGTATAGTAAGCAGGG - Intergenic
1097719584 12:63005500-63005522 AGACAAACTCATAGTGAGGAAGG - Intergenic
1101558184 12:105830607-105830629 TGACAGAGGCAGAGATAGGAGGG - Intergenic
1104266533 12:127238473-127238495 TGGCAGAGTCATTGTGAGGAAGG - Intergenic
1104859797 12:131918071-131918093 TGCCAGCCCCATAGCGAGGATGG + Intronic
1106763839 13:32894065-32894087 GGACAGAGGCAGAGAGAGGAAGG - Intergenic
1108861909 13:54871109-54871131 TGACAGAGACATAGGTAAGAAGG - Intergenic
1108910846 13:55549973-55549995 AGAGAGAGAGATAGTGAGGAGGG - Intergenic
1109994712 13:70108123-70108145 TGGCAGAGCCTTAGTAGGGAAGG + Exonic
1110963896 13:81666462-81666484 TGCCAGAGCAATAGTCAGGCAGG - Intergenic
1111116366 13:83783250-83783272 TGATATAGCAATAATGAGGATGG + Intergenic
1112898783 13:104334821-104334843 TGACACAGCCTTGGAGAGGAAGG + Intergenic
1114337282 14:21703700-21703722 TCACAGGGCCTTAGTGAAGAAGG + Intergenic
1115843391 14:37497766-37497788 TGACAGTGCCATTCTGAGGGAGG + Intronic
1118910179 14:70055608-70055630 TGAGAAAGCAATTGTGAGGAAGG - Intronic
1122606684 14:102951316-102951338 TCACAGACCCATGGTCAGGAAGG + Intronic
1124660639 15:31548229-31548251 TGACAGAGGCAAAGTGAAGGGGG - Intronic
1127910301 15:63411025-63411047 TCACAGAACCATAGAGAAGAGGG + Intergenic
1128077597 15:64837641-64837663 TGACAGAAGCTTAGTGAGCAAGG - Intergenic
1128627800 15:69229255-69229277 TGACAGAGCTAAAATGAGTATGG + Intronic
1128903767 15:71449504-71449526 TCACAGAGTCATTGTGAAGATGG + Intronic
1129114536 15:73357885-73357907 TGACAGAGCCAGAAAGAGGGAGG + Intronic
1129270495 15:74417007-74417029 TGGCAGAGCCCTGATGAGGAGGG + Intronic
1131948969 15:97660050-97660072 TGAGAGATGCAAAGTGAGGAGGG - Intergenic
1132637082 16:956111-956133 TGACAGTGCCATTGTGGGGTGGG - Intronic
1133709095 16:8383976-8383998 TGACACTTGCATAGTGAGGAAGG + Intergenic
1140229043 16:73102218-73102240 TGCAAGAGCAATCGTGAGGATGG - Intergenic
1140462813 16:75154661-75154683 TGACAGAGACAGAGGGAGGGGGG + Intronic
1140693044 16:77502908-77502930 TCACAAAGGCCTAGTGAGGAAGG - Intergenic
1142294462 16:89211390-89211412 TGCCAGAGCCATGGTCAGGCAGG - Intergenic
1143457416 17:7077205-7077227 TGACGGACCCATAGTCAGGATGG - Intronic
1143605532 17:7983003-7983025 TGACAGAGCCATAATGTCGCGGG + Intergenic
1145959698 17:28880149-28880171 GGCCAGGGCCATAGGGAGGATGG + Exonic
1146407755 17:32553975-32553997 AGGCAGAGCCATAGAAAGGAGGG - Intronic
1147145429 17:38481987-38482009 AGACAGAGCCAGAGTGAGCTGGG - Intronic
1148767443 17:50047395-50047417 GGAGAGAGCCATTGTGGGGATGG + Intergenic
1150593639 17:66584729-66584751 TGACAGAGCCAAAGGGAAGAAGG - Intronic
1151383258 17:73739966-73739988 GGACAGAGCCAGGGTCAGGAGGG - Intergenic
1152800068 17:82326850-82326872 TGTCAGAGCAATTGTGGGGAAGG - Intronic
1153543680 18:6184704-6184726 TGATCCAGCCATATTGAGGATGG + Intronic
1155117484 18:22783899-22783921 GGACAGAGCCCCAGGGAGGAGGG - Intergenic
1155159338 18:23183040-23183062 CGACAGAGCATTAGTGAGGAGGG + Intronic
1155169806 18:23259153-23259175 TGACAGACCCCATGTGAGGAAGG - Exonic
1155403528 18:25463512-25463534 AGACAGGGCCAGAGAGAGGAAGG - Intergenic
1156053924 18:32974674-32974696 TGACAGAGCTAAAGGGAAGAGGG + Exonic
1156473457 18:37391532-37391554 TGACAGAGACATGGGGTGGAGGG - Intronic
1157578123 18:48757573-48757595 TGACAGAGTCAGAGGCAGGAGGG + Intronic
1159206664 18:65262618-65262640 TCACAGAGGCATAATGATGAAGG - Intergenic
1159323230 18:66881922-66881944 TGACAGCGACTTAGTGAAGAAGG - Intergenic
1159801383 18:72904493-72904515 GGACAGAGACACAGAGAGGAAGG + Intergenic
1160191126 18:76714671-76714693 TGACAGAGACAGACTCAGGAGGG - Intergenic
1160572844 18:79830662-79830684 GGACAGAGCCTTTGTCAGGAGGG + Intergenic
1160572850 18:79830693-79830715 AGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572856 18:79830724-79830746 AGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572863 18:79830755-79830777 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572870 18:79830786-79830808 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572879 18:79830848-79830870 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572892 18:79830910-79830932 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572899 18:79830941-79830963 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572906 18:79830972-79830994 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572913 18:79831003-79831025 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572920 18:79831034-79831056 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572927 18:79831065-79831087 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572934 18:79831096-79831118 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572941 18:79831127-79831149 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572948 18:79831158-79831180 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572955 18:79831189-79831211 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572962 18:79831220-79831242 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572969 18:79831251-79831273 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572976 18:79831282-79831304 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572983 18:79831313-79831335 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572990 18:79831344-79831366 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160572997 18:79831375-79831397 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160573004 18:79831406-79831428 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160573011 18:79831437-79831459 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160573018 18:79831468-79831490 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160573025 18:79831499-79831521 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160573049 18:79831654-79831676 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1160573056 18:79831685-79831707 GGACAGAGCCTTCGTCAGGAGGG + Intergenic
1161675496 19:5645808-5645830 TGACAGAGCCCTGTTGGGGAAGG + Intronic
1161841611 19:6684946-6684968 GGAGACAGCCAGAGTGAGGAGGG + Intronic
1162308737 19:9892039-9892061 TGAAACTGGCATAGTGAGGAGGG + Intronic
1162509218 19:11107368-11107390 TGTGAGAGCCAGAGAGAGGAAGG - Intronic
1164573587 19:29391976-29391998 TGGCAGAGCCACAATGTGGAAGG + Intergenic
1164929789 19:32166555-32166577 AGAAAGAGCCATATGGAGGAAGG + Intergenic
1165871640 19:38976753-38976775 CCACAGCGCCATCGTGAGGACGG + Intergenic
1166554603 19:43689925-43689947 GAACAGAGGCCTAGTGAGGAAGG + Intergenic
1167266944 19:48487931-48487953 GGACAGAGCCACATTGAGCAGGG + Intronic
1167634335 19:50645395-50645417 AGACAGAGACATAGAGAGAAAGG + Intronic
926955374 2:18289218-18289240 TGAAATGGCCACAGTGAGGAAGG - Intronic
927071177 2:19530998-19531020 TGACAGAGCAAAGGTGAAGATGG - Intergenic
927089586 2:19700430-19700452 TGACAGGGACAGAGTGAGCAGGG + Intergenic
927338591 2:21953727-21953749 TGACAGATCTGAAGTGAGGAAGG - Intergenic
928923796 2:36555291-36555313 GGACAGATCATTAGTGAGGACGG - Intronic
930590080 2:53316591-53316613 TGACAGAGCCACAGGATGGAGGG + Intergenic
931086604 2:58838213-58838235 TGAAAGAGACAAAGAGAGGAAGG - Intergenic
931837113 2:66110737-66110759 TGACACAGACTTAGGGAGGATGG + Intergenic
932702095 2:73999117-73999139 GGACACAGCCATGGTGAGGGAGG + Intronic
933635245 2:84701715-84701737 TGACAGCACCAAAGGGAGGATGG + Intronic
933801416 2:85963238-85963260 TGACTAAGCTAGAGTGAGGAAGG + Intergenic
936905614 2:117532843-117532865 TGAGAGAGACAGAGTGAGGGAGG - Intergenic
937547744 2:123044736-123044758 TAAAAGAGCAAGAGTGAGGAGGG - Intergenic
939346403 2:140971238-140971260 TGACAGAGACATGGGGAAGAAGG + Intronic
944105500 2:196075486-196075508 GGCCAGGACCATAGTGAGGAAGG + Intergenic
944681295 2:202079346-202079368 TCAAAGAGCCAAAGTGAGGATGG + Intronic
945471261 2:210230036-210230058 AGACAGAGAGAGAGTGAGGAAGG + Intergenic
946487866 2:220118044-220118066 TGACAGATTCAGAGTGAGGAAGG - Intergenic
947199768 2:227604532-227604554 TCACAGAGCCAAAGAGATGATGG - Intergenic
947391196 2:229641258-229641280 GGACACAGCCACAGTGAGGCTGG + Intronic
948663203 2:239519294-239519316 AAACAGAGCCATAGTGATCAGGG - Intergenic
948932726 2:241142343-241142365 GGACTGGGCCATGGTGAGGAAGG - Intronic
1169409752 20:5357857-5357879 TGCCAGTGCAATGGTGAGGAAGG + Intergenic
1170414076 20:16121548-16121570 TGACAGAGGGATCGTGAAGAAGG - Intergenic
1171975332 20:31591016-31591038 TGAGACAGACAAAGTGAGGAAGG - Intergenic
1172343845 20:34181169-34181191 TGAGAGAGCTTTAGTGAGGAGGG - Intergenic
1177286314 21:19055916-19055938 TGACTGAAGCTTAGTGAGGAAGG + Intergenic
1178427747 21:32492340-32492362 GGACAGGGGCATATTGAGGAGGG + Intronic
1178791573 21:35705108-35705130 AGACAGAGACAGAGAGAGGAAGG + Intronic
1179873304 21:44254619-44254641 TGTCACAGACACAGTGAGGAAGG - Exonic
1180065570 21:45410463-45410485 GGCCAGAGCCACAGGGAGGAAGG + Intronic
1180821574 22:18832531-18832553 TGTAAGAGCCATACTGATGAGGG + Intergenic
1181191404 22:21143514-21143536 TGTAAGAGCCATACTGATGAGGG - Intergenic
1181207795 22:21266996-21267018 TGTAAGAGCCATACTGATGAGGG + Intergenic
1181465345 22:23107870-23107892 CGACGAAGCCACAGTGAGGAAGG + Intronic
1181784056 22:25213367-25213389 TGACAGATACATAGAGAGAAAGG - Intergenic
1182276523 22:29192674-29192696 TGACACAGCAATCGTGTGGAAGG + Intergenic
1184275258 22:43406223-43406245 GGACAGAGGGATAGCGAGGAGGG - Intergenic
1184602627 22:45552571-45552593 TAAAAGAGCCATATTTAGGAGGG + Intronic
1185060283 22:48603037-48603059 TCACTGAGCCATTGTGAGAATGG - Intronic
1185206724 22:49543399-49543421 TGAAAGACCCATGGAGAGGAAGG + Intronic
1203219126 22_KI270731v1_random:28420-28442 TGTAAGAGCCATACTGATGAGGG - Intergenic
1203271699 22_KI270734v1_random:58407-58429 TGTAAGAGCCATACTGATGAGGG + Intergenic
949300253 3:2575489-2575511 TGACAGAGCCAGACTCAGGAAGG + Intronic
949563247 3:5221830-5221852 ACACAGAGCCAGAGTGGGGAGGG - Intergenic
949908331 3:8878100-8878122 TGACAGAGCAGCGGTGAGGAGGG + Exonic
950095463 3:10326924-10326946 TGACACAGCCATCGTGAGGAGGG + Exonic
950394202 3:12721219-12721241 TGTCACAACCATGGTGAGGAGGG - Intergenic
950851096 3:16063171-16063193 TGACAGAGACATATGGATGAAGG + Intergenic
951752636 3:26054527-26054549 TGACAGAGAAATAGGGATGATGG + Intergenic
951768308 3:26225360-26225382 TCACAGTGCCATAAAGAGGAAGG + Intergenic
951891023 3:27568313-27568335 TGACAGAGGCATTTAGAGGAGGG + Intergenic
952983026 3:38753670-38753692 TGACACATCCATATTAAGGAAGG + Intronic
953036916 3:39220174-39220196 TGACAGAGCTGTAGAGAAGATGG + Intergenic
953501909 3:43444731-43444753 TGACACAGTCATGGCGAGGACGG + Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
955066998 3:55542362-55542384 TCACAGAGCCACAGTGAGTATGG - Intronic
955368502 3:58331936-58331958 TGCCAGAGCCATGGAGATGATGG + Intergenic
955392381 3:58531001-58531023 TGACAGAGCAATCGTGGGGTGGG - Intronic
956141194 3:66148429-66148451 TGACAGGACCATGGCGAGGATGG + Intronic
956654343 3:71534656-71534678 GGACAGAGCCAGAGTGGGGTTGG + Intronic
956740163 3:72269484-72269506 TGACAGAGCCATTCAGATGAAGG + Intergenic
957258753 3:77872884-77872906 TGACACAGCCATAGAAAAGATGG - Intergenic
957351237 3:79024089-79024111 TTACAGAGCAATAGCGAGGCTGG - Intronic
957757088 3:84504116-84504138 TGACAGAGACAGAGAGAGAAAGG + Intergenic
961346288 3:126265542-126265564 TGAAAGACCCAAAGTGGGGAGGG - Intergenic
963103460 3:141625854-141625876 GGACTGAGCCACAGAGAGGAGGG - Intergenic
967174578 3:186851661-186851683 TGAGAGAGCCAGAGAAAGGAAGG - Intronic
968753316 4:2401552-2401574 TCACAGAGCCAGAAGGAGGAGGG - Intronic
969446787 4:7249534-7249556 TGACAGTGGCACAGTAAGGATGG - Intronic
970571752 4:17390219-17390241 TGACAGAACCAAAGTCATGAGGG - Intergenic
970644164 4:18100414-18100436 TAACACAGCCATTGTGTGGAGGG - Intergenic
971232329 4:24809693-24809715 TGACAGAGCCACAGTGGGACTGG + Intronic
972386869 4:38575330-38575352 TGACACAGTCAAAGTTAGGATGG - Intergenic
972585441 4:40433303-40433325 TGAGAGAACAATAGTGAGCATGG - Intronic
974434089 4:61834635-61834657 TGACAGGGCCATAGTGAGAATGG + Intronic
976467132 4:85383564-85383586 AGACAGAGACATAGGGAAGATGG + Intergenic
976538892 4:86249915-86249937 TGACAGAACCATCCTGAGAATGG + Intronic
981020790 4:140025959-140025981 TGACATAGCCACAGTGATCAGGG - Intronic
981803214 4:148682056-148682078 TGACTGGGACATAGTGAGTAAGG + Intergenic
982158384 4:152542562-152542584 TGACTTAGCCAGAGTCAGGAGGG + Intergenic
982925440 4:161331573-161331595 TGCCAGAGCCATGGTCAGGCAGG - Intergenic
983043135 4:162954316-162954338 TGACAGAGACAGAGGGAGGGGGG + Intergenic
984878612 4:184391027-184391049 GGACAGAGCTGCAGTGAGGAGGG - Intronic
985950978 5:3221094-3221116 TGACAGAGCTATCATGCGGAAGG - Intergenic
986697789 5:10373983-10374005 TGACAGGGCCATGGTGGGGGTGG - Intronic
986796803 5:11220482-11220504 TGACAGTGCCATTGTTAGGAGGG - Intronic
987118012 5:14741833-14741855 TGACAGAGCCATGCAGACGAAGG + Exonic
987284965 5:16446982-16447004 TGGCAGAGCAATAGTATGGAAGG - Intergenic
990074055 5:51820636-51820658 TCATAGAGCTATAGTCAGGAAGG - Intergenic
991173520 5:63657509-63657531 AGACAGAGACAGAGAGAGGATGG + Intergenic
991409789 5:66334564-66334586 TGACAGAACCATGATCAGGATGG + Intergenic
992081935 5:73241661-73241683 GGAAAGAGTGATAGTGAGGAGGG + Intergenic
993030237 5:82697205-82697227 TGACACAGCCTCAGTGAGGTGGG + Intergenic
993030247 5:82697275-82697297 TGACACAGCCTCAGTGAGGTGGG + Intergenic
994321642 5:98401612-98401634 TGTCAGAGCCAAAGTAGGGAAGG - Intergenic
994566614 5:101454760-101454782 TCACTTAGACATAGTGAGGAAGG + Intergenic
994626513 5:102226712-102226734 TGAGAAAGCCCTAGTGATGAAGG - Intergenic
997584458 5:135035980-135036002 TCACAGACCCACAGTGAGAAAGG - Intronic
999707087 5:154283493-154283515 TGACAGAGTGAGAGTGAGGTGGG + Intronic
1000204578 5:159046700-159046722 TGACAAAGACATAGTATGGAGGG + Intronic
1000210262 5:159101356-159101378 TGGCAGAGACAGAGTTAGGAAGG - Intergenic
1001743996 5:174076167-174076189 TGAGAGAGCCATTGTGATGATGG + Intronic
1001759504 5:174195505-174195527 AAACAGAGCCATAGAGAGGTTGG + Intronic
1003861509 6:10326455-10326477 TGACAGAGACATACTCAGGAAGG - Intergenic
1004752748 6:18580627-18580649 TGACAGTGTCACAGTGTGGAGGG + Intergenic
1007350365 6:41268958-41268980 GGACAGAGCCATGGGCAGGATGG - Intronic
1011130454 6:84046888-84046910 TGACAGAGTCATAGACAGGTGGG - Intronic
1012741790 6:103025998-103026020 GGTCAGAGCTATAGTGATGAGGG + Intergenic
1014042323 6:116843194-116843216 TCACAGAGCCATAATCATGATGG + Intergenic
1015595898 6:134866359-134866381 TGACAGAGCAAGACTCAGGAAGG + Intergenic
1015603401 6:134932731-134932753 TGACAGGGCCATGGAGGGGAGGG + Intronic
1015655088 6:135508969-135508991 TGACAGACCAATAATGAGTATGG - Intergenic
1016274834 6:142336966-142336988 TGAGAGAGCTAAAGTGTGGATGG + Intronic
1016607057 6:145941738-145941760 CCACATAGCAATAGTGAGGATGG - Exonic
1018070522 6:160160898-160160920 TGTCACAGCAACAGTGAGGAAGG - Intergenic
1018320126 6:162599618-162599640 TGACAGAGCCCAGGTGAAGATGG + Intronic
1018362048 6:163080381-163080403 TGACAGTGCCACAGTGCTGATGG + Intronic
1018405434 6:163476919-163476941 TGACAGAGCTATAGTGATGATGG - Intronic
1018961557 6:168452983-168453005 TGTCAGAGCCACTGGGAGGAGGG - Intronic
1019922114 7:4169574-4169596 TGCCAGAGACTGAGTGAGGAAGG - Intronic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1022335047 7:29414454-29414476 TCTCAGAGCCGTTGTGAGGACGG - Intronic
1023021424 7:36015143-36015165 TGACACTGCCCCAGTGAGGAAGG + Intergenic
1023351426 7:39323769-39323791 TGAGAGAGAGAGAGTGAGGAAGG + Intronic
1025111448 7:56220119-56220141 TGACAGAGAGAAAGAGAGGAAGG + Intergenic
1025753656 7:64314106-64314128 TGGGAGATCCATAGGGAGGACGG + Exonic
1025862738 7:65347129-65347151 TGGCAGAGACATAGTGAAAAAGG - Intergenic
1026480757 7:70777273-70777295 TTACAGACCCATAGTTAGGAAGG + Intronic
1027900907 7:84113258-84113280 TGACAGAGACATTGTTAGTAAGG + Intronic
1029530375 7:101121521-101121543 TCACAGAGCCAGGGTAAGGAAGG + Intergenic
1030766036 7:113410913-113410935 TCTCAAAGCCTTAGTGAGGAGGG - Intergenic
1030774828 7:113521526-113521548 TCACAGAGCCACAATGATGATGG + Intergenic
1031034445 7:116773104-116773126 TGACAGAGCTTTGGTGAGTAAGG - Intronic
1031220250 7:118956522-118956544 TGACAGAGACAGAGGGAGGGGGG + Intergenic
1031567910 7:123322317-123322339 TGACAGAGCCATGGTCAGGAAGG - Intergenic
1032248681 7:130234313-130234335 TAAGTGAGCCACAGTGAGGAAGG + Intergenic
1032526286 7:132580409-132580431 TCACAGAGCCATTGTCAGTAGGG - Intronic
1032734844 7:134682576-134682598 AGACAGAGCCAGAGTTAGTAGGG - Intergenic
1033261384 7:139846848-139846870 GGACAGAGCCATAGTGCGGCAGG + Intronic
1035007143 7:155674099-155674121 TGACAGAGCCATCTAAAGGAGGG - Intronic
1036439335 8:8766400-8766422 TGATGGAGCCATATTGAGGATGG - Intergenic
1041608946 8:59820960-59820982 TCACAGAGACATACTGAGGGAGG + Intergenic
1043141025 8:76590934-76590956 CAACAAAGGCATAGTGAGGAGGG - Intergenic
1044542138 8:93419929-93419951 AGACAGAGACAGAGAGAGGAAGG - Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1046303253 8:112326637-112326659 TGAATGACCCATTGTGAGGAAGG - Intronic
1047221326 8:122921028-122921050 TTATAGGGCCATTGTGAGGATGG + Intronic
1047497890 8:125421539-125421561 GGAACGAGCCATAGTGAGAAAGG - Intergenic
1047549959 8:125860161-125860183 TGACTGAGCCATAGTCAGATCGG - Intergenic
1047657208 8:126991144-126991166 TCACAGAGCTATTGTGAAGATGG + Intergenic
1048036571 8:130682930-130682952 TGGCAGAGCCACAGGGAGCACGG - Intergenic
1048136641 8:131752779-131752801 TCACTGAGCCAGAGTGGGGAAGG + Intergenic
1048519420 8:135140002-135140024 TGAGGGAGCTATAGGGAGGAAGG - Intergenic
1048992261 8:139767443-139767465 GGACGGAGCCCTCGTGAGGACGG - Intronic
1050363812 9:4855683-4855705 TGCCAGAGACATAGGGAGAATGG + Intronic
1051151707 9:14086922-14086944 TGACAGATCCATAGTGTGCATGG - Intronic
1051857757 9:21588895-21588917 TGAGATAGCCACAGGGAGGATGG + Intergenic
1052176803 9:25472554-25472576 GGAAAGAGCCCTAGGGAGGAGGG - Intergenic
1052748939 9:32469090-32469112 TGACAGAGCCATAACAAGGAAGG + Intronic
1052887182 9:33661127-33661149 TGACAGAGGAAGAGTGAGCAGGG + Intergenic
1053000691 9:34575774-34575796 TGACAGAGCCAGAGTTGGGTGGG + Intronic
1053944795 9:43295993-43296015 TCACAGATCCAGAGAGAGGAGGG + Intergenic
1055062293 9:72082337-72082359 TGCCAGAGCCATAAGGAGCAGGG - Intergenic
1055071856 9:72174804-72174826 AGACAGAGACAGAGTGGGGATGG + Intronic
1055664190 9:78536916-78536938 TGACATAGGCATTGTGAGGTAGG - Intergenic
1056499895 9:87198406-87198428 TGACAGAGCCAGAATTATGAAGG - Intergenic
1057410480 9:94812918-94812940 TTATTGAGCCAAAGTGAGGATGG + Intronic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1058447175 9:105064482-105064504 TGCCAGAAGCATAGTGGGGAAGG + Intergenic
1058735146 9:107887284-107887306 AGACAGGGCAATAGGGAGGAAGG - Intergenic
1059629045 9:116099789-116099811 TCACAGAGCAGTAGTGATGATGG + Intergenic
1060939252 9:127534332-127534354 TCACAGAACTATAGAGAGGATGG - Intronic
1203587930 Un_KI270747v1:24571-24593 TCACAGATCCAGAGAGAGGAGGG + Intergenic
1185735309 X:2491364-2491386 TGACAGAGGCATTGTCAGGCTGG - Intronic
1185966819 X:4614907-4614929 AGACAGAGACAGAGAGAGGAGGG + Intergenic
1186980611 X:14954182-14954204 TGGCAGAGCCATAAGGTGGAAGG + Intergenic
1188074666 X:25760236-25760258 TGTCAGAGCACCAGTGAGGAAGG - Intergenic
1192268222 X:69555212-69555234 TGAAAGAGTAAAAGTGAGGAGGG + Intergenic
1192402370 X:70848834-70848856 TGACAGGGTCACACTGAGGAAGG - Intronic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1192800340 X:74459487-74459509 TGGCAGAGCCCCAGTGGGGAGGG - Intronic
1194663171 X:96648391-96648413 TGACAGTGCCAGATAGAGGAGGG - Intergenic
1195941917 X:110174139-110174161 TGACAAATCCAAAGTGAAGAGGG + Exonic
1197587634 X:128368880-128368902 TGACAGAGTCATAATGTGGAAGG - Intergenic
1199119177 X:144030257-144030279 TTACAGACTCATAGGGAGGAGGG + Intergenic
1199675146 X:150182322-150182344 AGCCAGAGGCAGAGTGAGGAAGG + Intergenic
1201900461 Y:19042783-19042805 TTACAGAGACAGAGGGAGGAGGG - Intergenic