ID: 1075408995

View in Genome Browser
Species Human (GRCh38)
Location 10:122213601-122213623
Sequence CCTGATAAGCAGGCAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075408995_1075408999 9 Left 1075408995 10:122213601-122213623 CCAGCATCTGCCTGCTTATCAGG 0: 1
1: 0
2: 1
3: 12
4: 200
Right 1075408999 10:122213633-122213655 TTTTTCCTTCCCTTGCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075408995 Original CRISPR CCTGATAAGCAGGCAGATGC TGG (reversed) Intronic
901710817 1:11113722-11113744 CCTGCTCAGGAGGCAGAGGCAGG - Intronic
902733619 1:18385744-18385766 CCTCATGAGCTGGCAGCTGCTGG - Intergenic
904431182 1:30465565-30465587 CCTGAGAAGCAAGCAGGTGTTGG - Intergenic
905629604 1:39511294-39511316 CCTGTTGAGCAGGTGGATGCTGG - Exonic
905668155 1:39774896-39774918 CCTGTTGAGCAGGTGGATGCTGG + Exonic
905947921 1:41919316-41919338 CCTGATCTGCAGCCAGAGGCTGG - Intronic
906785138 1:48609071-48609093 GCTGATAACCAGGCAGACACAGG + Intronic
908713722 1:67047678-67047700 TCTGTGAAGCAGGCAGAAGCAGG + Intronic
912265059 1:108149227-108149249 ACTGATAGCCAGGGAGATGCTGG - Intronic
912711116 1:111950610-111950632 CTTGAAAGGCAGGCAGATGAAGG + Intronic
913091408 1:115479080-115479102 CCTGGGACGCAGGCAGCTGCTGG - Intergenic
915594711 1:156889850-156889872 CCTGCCAGGAAGGCAGATGCAGG - Intergenic
917143214 1:171858681-171858703 CCTGATAAGCAGCCAGATATGGG + Intronic
918040299 1:180910201-180910223 CATGTTGAACAGGCAGATGCTGG + Intergenic
918424406 1:184393400-184393422 CCTGAGAAACAGGCAGAGGCAGG - Intronic
921071596 1:211663437-211663459 ACTGAAAAGCAGACAGATCCTGG - Exonic
921452892 1:215330434-215330456 CATGATATGCAAGCAGATGAAGG - Intergenic
923068988 1:230545646-230545668 CCTGATCATCAGGAAGAGGCAGG + Intergenic
923507058 1:234612991-234613013 ACGGACAGGCAGGCAGATGCTGG + Intergenic
1065431720 10:25664955-25664977 CCTGAAGAGCAGCCAGTTGCTGG - Intergenic
1070002802 10:72393657-72393679 CGAGAAAAGGAGGCAGATGCAGG + Intronic
1071562488 10:86655081-86655103 CCTGATAAACAGGCTGATAGAGG + Intronic
1072575242 10:96693524-96693546 CCAGATAAGCTGACAAATGCAGG + Intronic
1073469988 10:103716325-103716347 CCTGATGGGCAGGCTGAGGCAGG + Intronic
1075237437 10:120743746-120743768 CATGATAAGGAGGCAGAGGCTGG + Intergenic
1075408995 10:122213601-122213623 CCTGATAAGCAGGCAGATGCTGG - Intronic
1075804464 10:125175566-125175588 CCTCATGAGTAGGCAGAGGCTGG - Intergenic
1078576105 11:12503910-12503932 CCTGGAAGCCAGGCAGATGCCGG - Intronic
1080265743 11:30400169-30400191 GCTGATTAGGAGGCTGATGCAGG - Intronic
1082778747 11:57269756-57269778 CCTGAAAGGCAGACAGAGGCTGG - Intergenic
1083372350 11:62192443-62192465 CCTGAGAAGGAGGAACATGCAGG - Intronic
1083474303 11:62906075-62906097 TCTGATAAGCAGGCTCAGGCGGG + Intergenic
1084071655 11:66740468-66740490 CCTGATAAGAAAGCAGAGGGAGG + Intergenic
1088808651 11:113374293-113374315 CTTGATGTACAGGCAGATGCTGG - Intronic
1091174728 11:133547760-133547782 CCTGAGAAGCAGTCAGCTGGAGG - Intergenic
1091589276 12:1833837-1833859 GGTGATGAGCAGGCAGATTCGGG + Intronic
1091918187 12:4284031-4284053 CCTGGATTGCAGGCAGATGCAGG - Intronic
1092668920 12:10840028-10840050 CCTACTCAGCAGGCAGAGGCAGG + Intronic
1093299184 12:17432593-17432615 GCTGCTTAGCAGGCTGATGCAGG + Intergenic
1094076347 12:26479825-26479847 GCTTATCAGGAGGCAGATGCTGG + Intronic
1094824493 12:34258916-34258938 CCTGGTAAGAAGACAAATGCTGG + Intergenic
1095086724 12:38064430-38064452 CCTGGTAAGAAGACAAATGCTGG - Intergenic
1095328064 12:40922335-40922357 CCTGACAAACAGAAAGATGCTGG + Exonic
1098758952 12:74399672-74399694 CTTGGTAAGCACGCAGATGTTGG - Intergenic
1099617532 12:84956683-84956705 CCTGTTAAGTAGTCAGATGTAGG - Intergenic
1100196022 12:92245972-92245994 CCTGCTCAGCAGGCTGACGCAGG - Intergenic
1101196679 12:102390648-102390670 GCTGATAAGCAGACAAGTGCTGG + Intergenic
1101219708 12:102625859-102625881 CCTCATAATCAGGAAGATGTGGG - Intergenic
1101750401 12:107578781-107578803 CCTAAGAAGCAGGCTGATTCAGG + Intronic
1102788574 12:115624221-115624243 CCTAATGAGCCGGGAGATGCCGG - Intergenic
1104643984 12:130484257-130484279 CATGAGAGGCAGGCAGATGGTGG - Intronic
1106407281 13:29484920-29484942 GCTGAATAGCAGGCAGCTGCGGG + Intronic
1106407521 13:29486975-29486997 CCTGGTAGGCAGGCAGGTGAGGG + Intronic
1107997106 13:45871784-45871806 CTTGATAAACATGGAGATGCAGG - Intergenic
1112225044 13:97531571-97531593 TCCCCTAAGCAGGCAGATGCAGG + Intergenic
1113901335 13:113800013-113800035 CCAGACAAGCTGGCAGGTGCTGG - Intronic
1117942671 14:60985173-60985195 TCTGACTAGCAGGCAGATGGGGG - Intronic
1118055653 14:62077047-62077069 CCTGCAAAGCAGGCAGTTACGGG - Intronic
1119306089 14:73609325-73609347 CCTGGAAAGCTGGCAGATGATGG + Intergenic
1120145755 14:80976655-80976677 CCTGATCAGGAGGAAGAAGCAGG - Intronic
1121656259 14:95598019-95598041 CCTGCTAATCAGGCAGGAGCCGG + Intergenic
1124839654 15:33229768-33229790 CCTGCTAAGGAGGCTGAGGCAGG + Intergenic
1129157014 15:73724522-73724544 CCTGGGATGCAGGCAGAGGCAGG - Intergenic
1131633383 15:94203609-94203631 TCTGATAGGCAGGCACATCCTGG - Intergenic
1132332595 15:101023113-101023135 CCTCATCAGGGGGCAGATGCTGG - Intronic
1133196202 16:4172510-4172532 CCTGACGAGTAGGAAGATGCAGG + Intergenic
1135622822 16:23970450-23970472 GCTGATGTGCAGGCAGATACTGG + Intronic
1137280353 16:46971903-46971925 CCTGATAAGAATCCAAATGCAGG - Exonic
1137815364 16:51393089-51393111 CCTGGTATCCAGGCAGATGGGGG - Intergenic
1139188676 16:64836723-64836745 CCTGATCAGCAGGAGGAGGCGGG - Intergenic
1139267946 16:65657215-65657237 CCTGTGAAGGAGGCAGATTCGGG - Intergenic
1142105926 16:88302754-88302776 CCTGGAAAGCAGACAGATGCAGG - Intergenic
1142527856 17:557253-557275 CGTGAGAAGGAGGCAGAGGCTGG - Intronic
1142751185 17:1988798-1988820 CCAGGTAAGCAGGCTGAGGCAGG + Intronic
1144279329 17:13709056-13709078 TCTGATACCCAGGCACATGCTGG - Intergenic
1146105114 17:30027820-30027842 CCTGGTAAGCAGGAAGACGTGGG - Intronic
1150843371 17:68630420-68630442 CCTGAGAGGCAGGAACATGCAGG + Intergenic
1155070769 18:22314067-22314089 CCTTAGAAGCAGGCTGATGGGGG - Intergenic
1158645213 18:59239884-59239906 CTTGATAAGCAAGCAGAGCCTGG + Intergenic
1159443239 18:68508390-68508412 CCTGGGAAGCAGGAATATGCAGG + Intergenic
1159740953 18:72169462-72169484 CGTGAGAAGCATGCAGATACAGG - Intergenic
1160569491 18:79807148-79807170 CCTGAGGTGCAGACAGATGCAGG - Intergenic
1162036312 19:7941651-7941673 TCTGAGAAGCAAGCAGAAGCTGG + Intronic
1162425593 19:10593544-10593566 CCTTCTCAGCAGGCAGTTGCTGG - Intergenic
1162750195 19:12824947-12824969 CCTGCTCAGCAGGCTGAGGCAGG - Intronic
1163662634 19:18587995-18588017 CCGGAGGAGCAGGAAGATGCTGG - Intronic
1163989610 19:20986067-20986089 CCTGAGAAACAAGAAGATGCAGG + Intergenic
1164600623 19:29560977-29560999 CCTGACATGAAGGCAGGTGCAGG - Intronic
1164807079 19:31125290-31125312 CCTGGGAAGCCTGCAGATGCTGG + Intergenic
1165203576 19:34165179-34165201 CCTGGGAAGCAGGGAGCTGCAGG - Intergenic
1167206312 19:48104969-48104991 GCTGCTCAGCAGGCTGATGCAGG + Intronic
925059777 2:881766-881788 CCTGCTCAGCAGGCACAGGCAGG + Intergenic
925154994 2:1642170-1642192 GCAGATGAGGAGGCAGATGCAGG + Intronic
926297974 2:11582183-11582205 CCTGAACAGCAGGGAGATGAGGG + Intronic
931003223 2:57814432-57814454 GCAGATCAGCAGGCAGAAGCTGG + Intergenic
931377630 2:61721587-61721609 CCTGATCAGCAGGTGGAGGCAGG + Intergenic
937939744 2:127275807-127275829 GCTGAAAAGCAGACAGATGCAGG + Intronic
937955031 2:127417300-127417322 GCTGATGAGAAGGAAGATGCAGG - Intergenic
938407542 2:131040783-131040805 CCTGCTTAGGCGGCAGATGCCGG + Intronic
939267323 2:139891003-139891025 CCTGAAAACCAGGCTGCTGCTGG + Intergenic
940638895 2:156328254-156328276 CCGGGCAAGCAGGCAGCTGCAGG + Intronic
943934427 2:193897332-193897354 CCTGATAATTAAGCATATGCTGG + Intergenic
946386112 2:219385531-219385553 CCTGAAGAGCAGAAAGATGCTGG + Exonic
946693847 2:222332930-222332952 CCTGCTCAGCAGGCATCTGCTGG + Intergenic
948634515 2:239326795-239326817 CCAGAGAAGCAGCCAGCTGCTGG - Intronic
1169353612 20:4889974-4889996 CCAGATAAGCCTCCAGATGCCGG + Intronic
1169853265 20:10076579-10076601 CCTGATAGGCAGGTAGATGCTGG + Intergenic
1170877163 20:20261319-20261341 TTTGACAAGCAGGCAAATGCTGG - Intronic
1171115857 20:22524256-22524278 GCTGAAAAGCAGGCAGATGTGGG - Intergenic
1171316315 20:24198858-24198880 ACTGACAGGCAGGCAGATGATGG - Intergenic
1172425377 20:34852202-34852224 CCTGCTCAACAGCCAGATGCTGG - Exonic
1173908263 20:46644653-46644675 CCTGATGAGCAGTGTGATGCAGG - Intronic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174469171 20:50743194-50743216 CCTGATAATCAGCCAGGTGGAGG + Intronic
1175182767 20:57160319-57160341 TCTCATAAGGAGGCAGACGCTGG + Intergenic
1175887178 20:62298815-62298837 CCTGAAAAGCACGAAGGTGCTGG - Intergenic
1176027441 20:62993320-62993342 CCTGGGAGGCAGGCAGAGGCTGG + Intergenic
1177703078 21:24663518-24663540 CCTGATAAGATCGCAGAAGCTGG - Intergenic
1178583655 21:33855883-33855905 CCTGGGGACCAGGCAGATGCAGG - Intronic
1180840558 22:18957037-18957059 CCTGATGCGCAGGCAGTGGCTGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183235333 22:36612626-36612648 CCAAATAACCAGGCGGATGCTGG - Intronic
1183720939 22:39560913-39560935 CCTGATATCCAGGAAGATGTGGG + Intergenic
1184321717 22:43746976-43746998 CCAGATAAGCAGCAGGATGCTGG - Intronic
1184424687 22:44402609-44402631 CCTGAGACGCAGGCAGATCCAGG - Intergenic
1184887397 22:47354810-47354832 CCAGGGAGGCAGGCAGATGCTGG - Intergenic
949809622 3:7992190-7992212 CCCAATAAGCAGGGAGAAGCAGG + Intergenic
952359535 3:32615760-32615782 CCTGCTCAGGAGGCTGATGCAGG + Intergenic
954367144 3:50152284-50152306 CCTGATAGGCACGCAGGAGCTGG - Intergenic
954842275 3:53522318-53522340 CCTGAGCAGCAGGTAGATGAGGG - Intronic
957576902 3:82019287-82019309 CATCATAAGCAGCCAGATACTGG - Intergenic
960138376 3:114128580-114128602 CCTGACAAGCAGGGACATCCTGG + Intergenic
963467598 3:145702390-145702412 CCTGGAAAGCTGGCAGATGGTGG + Intergenic
965043164 3:163536831-163536853 GATAAGAAGCAGGCAGATGCAGG - Intergenic
966168755 3:177052988-177053010 GCTGCTAAGGAGGCAGAGGCAGG + Intronic
967056029 3:185829173-185829195 CCTGATGCACAGGCAGGTGCAGG - Intergenic
968502656 4:958285-958307 CCTGCTCAGCAGGCAGGTGGAGG - Exonic
969429931 4:7148212-7148234 CTGGTTAAGCAGGCAGATGCTGG - Intergenic
969954080 4:10870380-10870402 CCTGATAAGAATCCAGATGTGGG + Intergenic
971090932 4:23344687-23344709 GGTGACAAGCAGGCATATGCAGG + Intergenic
971512767 4:27447550-27447572 GCTGCTAAGCAGGCTGAGGCAGG + Intergenic
972662789 4:41132488-41132510 CCTGATTAGCAATCAGATTCTGG + Intronic
972915046 4:43866623-43866645 AGTGAAAAGCAGGCAGATTCTGG - Intergenic
978653693 4:111040695-111040717 CATGAGAAGCACTCAGATGCTGG - Intergenic
978691720 4:111520905-111520927 TCTGATGAGCAGTCTGATGCTGG + Intergenic
978885956 4:113766674-113766696 CCTGAAAATAAGGCTGATGCTGG - Intergenic
982225951 4:153166658-153166680 CCTACTAGGGAGGCAGATGCAGG - Intronic
987990391 5:25201473-25201495 CCTAATTCGCAGGCAAATGCAGG + Intergenic
988713369 5:33800752-33800774 CCTTACAAGCAGGCACATGGGGG - Intronic
990282486 5:54266313-54266335 CCTACAAAGCAGGCAGAAGCTGG - Intronic
990551079 5:56879474-56879496 CCTGATAATAAGGCATATGCAGG - Intronic
992211056 5:74479914-74479936 CCTGGTGAGGAGGCAGATGATGG + Intergenic
994192438 5:96883202-96883224 CCTGGGAATCAGGCTGATGCTGG + Intronic
995653892 5:114402786-114402808 CCTGATATCCAGGCTGCTGCAGG - Intronic
998041523 5:138953631-138953653 CCAGATAGGCAGGCAGGCGCTGG + Intronic
1001002975 5:168024985-168025007 CCTGATAAGCACCTGGATGCTGG - Intronic
1001147492 5:169197504-169197526 CCTGATAAACAGGTAAGTGCCGG + Intronic
1001727440 5:173917893-173917915 CCAGACACGCAGGCAGCTGCCGG - Intronic
1001993430 5:176135085-176135107 ACTGATAAGGAGGGAGAGGCTGG + Intergenic
1002081109 5:176737953-176737975 CCTAGGAAGCAAGCAGATGCTGG + Intergenic
1003806512 6:9730954-9730976 GTTGATAAGCAGGCAGTTGCTGG - Intronic
1005658253 6:27966273-27966295 TCTGATCAGCAGGAAGAAGCAGG - Intergenic
1005809162 6:29503097-29503119 CAAGAGAAACAGGCAGATGCTGG - Intergenic
1006914633 6:37586306-37586328 CCTGATGACCAGACTGATGCTGG + Intergenic
1009920027 6:70045927-70045949 CATCAAAAGCAGGCAGATACTGG - Intronic
1013033879 6:106361360-106361382 TCTGGTTAGCAGGCTGATGCGGG - Intergenic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1016840345 6:148518858-148518880 CCTGACACGCAGGCAGCTCCAGG - Intronic
1018490483 6:164287735-164287757 CCTGTTGAGCAGGCAGGCGCTGG + Intergenic
1018632122 6:165830454-165830476 CCTCATATGGAGGCAGAGGCTGG - Intronic
1020125688 7:5531410-5531432 CCTCAAAAGCAGGCAGCTCCAGG - Intronic
1021341373 7:19466610-19466632 CCTGAAAAGCAGAGAGATACAGG - Intergenic
1022180364 7:27913132-27913154 CCTAATGAGGAGGCAGATTCTGG - Intronic
1025612013 7:63082847-63082869 CATGACAAGCGGGCAAATGCTGG - Intergenic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1027050741 7:75019785-75019807 CCTGAGATGCAGGCAGGGGCCGG + Intronic
1030969933 7:116044666-116044688 CCTAATCAACAGCCAGATGCTGG + Intronic
1031683531 7:124704245-124704267 CGTGATAAACATGCAAATGCAGG + Intergenic
1031913910 7:127544847-127544869 CCTGAAAGGCAGGGAGAAGCGGG + Intergenic
1034708727 7:153171355-153171377 CCTGTTTAGCAGGGAGCTGCTGG + Intergenic
1035206244 7:157295589-157295611 CCTGAAGTGAAGGCAGATGCTGG - Intergenic
1036165638 8:6430086-6430108 TCTGACAAGGAGGCAGATGTGGG - Intronic
1036678998 8:10856929-10856951 CCTAATAAGCAGTCAGAACCAGG - Intergenic
1037502768 8:19501136-19501158 CCTGCTAAGGAGGCTGAGGCAGG + Intronic
1037959596 8:23086035-23086057 CCTGAGAAGCAGCCAGCTGTGGG + Intronic
1038524524 8:28261648-28261670 TCTGGAAAGCAGGCAGCTGCAGG - Intergenic
1039107814 8:34008233-34008255 CCTGCTAGGGAGGTAGATGCAGG - Intergenic
1039605219 8:38874981-38875003 CATGATAAGCAGACACAAGCTGG + Intergenic
1039734823 8:40320543-40320565 CCTGAGAAGCAAGCTGAGGCTGG + Intergenic
1040646183 8:49399819-49399841 CCTGAAAAGCTGCTAGATGCAGG + Intergenic
1044840779 8:96335164-96335186 TGTGGGAAGCAGGCAGATGCTGG - Exonic
1045137158 8:99233498-99233520 CTTGATAAGAATGCTGATGCGGG + Intronic
1047065400 8:121276420-121276442 CCAGTGAAGCAGGCAGACGCAGG + Intergenic
1049353049 8:142174502-142174524 CCTGAGAAGCAGGCAGCAGAGGG - Intergenic
1049670724 8:143868621-143868643 GCTGATCAGCAGGAAGACGCTGG - Exonic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1053122815 9:35559158-35559180 CCAGATAAGGAGACAGATCCAGG - Intronic
1054875454 9:70091616-70091638 CCTAACAAGCAGCCAGATTCCGG - Intronic
1055892916 9:81142256-81142278 CCTGAGCAGCAGCCAGATCCAGG - Intergenic
1057261895 9:93589220-93589242 CTTTATAAGCAGGCAGATTTGGG + Intronic
1058633186 9:107010089-107010111 CCTGGGAGGCAGGCAGAAGCTGG - Intronic
1059454211 9:114389387-114389409 TCTGATAAGCAGCCAGATTTGGG + Intronic
1059528525 9:115015256-115015278 CCTGGGCAGCAGGCACATGCAGG + Intergenic
1059750090 9:117239430-117239452 CCAGAGAAGCAGGCAGATGTTGG + Intronic
1061800884 9:133112904-133112926 GCTGGTATCCAGGCAGATGCTGG + Intronic
1185662815 X:1740664-1740686 GCTGATCAGCAGGCTGAGGCAGG - Intergenic
1185662856 X:1740979-1741001 GCTGATCAGCAGGCTGAGGCAGG - Intergenic
1189960226 X:46317274-46317296 CCTGATCACCAGGCTGAGGCTGG + Intergenic
1189974715 X:46449213-46449235 CCAGTTAAAGAGGCAGATGCAGG + Intronic
1194287405 X:92026829-92026851 CCTGATTAGAAGGTAAATGCTGG + Intronic
1194349570 X:92809104-92809126 CCTGAACAGTAGGCAGAGGCAGG - Intergenic
1197774867 X:130112036-130112058 CAGGAGAAGCAGGCCGATGCTGG - Intergenic
1198264966 X:135000392-135000414 CCTCACCAGAAGGCAGATGCTGG + Intergenic
1200604942 Y:5251394-5251416 CCTGATTAGAAGGTAAATGCTGG + Intronic