ID: 1075410284

View in Genome Browser
Species Human (GRCh38)
Location 10:122222688-122222710
Sequence GACACTTTAGTGAGGCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075410274_1075410284 27 Left 1075410274 10:122222638-122222660 CCTAAAACTCACCCAGATTCAGC 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1075410284 10:122222688-122222710 GACACTTTAGTGAGGCGAGCTGG No data
1075410278_1075410284 5 Left 1075410278 10:122222660-122222682 CCACCAGAAGAGCTGAGGTTCCA 0: 1
1: 0
2: 0
3: 153
4: 3738
Right 1075410284 10:122222688-122222710 GACACTTTAGTGAGGCGAGCTGG No data
1075410275_1075410284 16 Left 1075410275 10:122222649-122222671 CCCAGATTCAGCCACCAGAAGAG 0: 1
1: 0
2: 0
3: 21
4: 275
Right 1075410284 10:122222688-122222710 GACACTTTAGTGAGGCGAGCTGG No data
1075410276_1075410284 15 Left 1075410276 10:122222650-122222672 CCAGATTCAGCCACCAGAAGAGC 0: 1
1: 0
2: 3
3: 86
4: 2332
Right 1075410284 10:122222688-122222710 GACACTTTAGTGAGGCGAGCTGG No data
1075410279_1075410284 2 Left 1075410279 10:122222663-122222685 CCAGAAGAGCTGAGGTTCCAAGT 0: 1
1: 0
2: 1
3: 82
4: 1784
Right 1075410284 10:122222688-122222710 GACACTTTAGTGAGGCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075410284 Original CRISPR GACACTTTAGTGAGGCGAGC TGG Intronic
No off target data available for this crispr