ID: 1075411731

View in Genome Browser
Species Human (GRCh38)
Location 10:122233462-122233484
Sequence CCCAGCACGGTTGAGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075411725_1075411731 -9 Left 1075411725 10:122233448-122233470 CCTAGCAAGAGGCCCCCAGCACG 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1075411731 10:122233462-122233484 CCCAGCACGGTTGAGTGGTGTGG No data
1075411718_1075411731 26 Left 1075411718 10:122233413-122233435 CCATACAAATAACAAGCTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 253
Right 1075411731 10:122233462-122233484 CCCAGCACGGTTGAGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075411731 Original CRISPR CCCAGCACGGTTGAGTGGTG TGG Intronic
No off target data available for this crispr