ID: 1075413942

View in Genome Browser
Species Human (GRCh38)
Location 10:122248947-122248969
Sequence GATGCAGGTGTAACCCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075413942_1075413947 -8 Left 1075413942 10:122248947-122248969 CCGCCTGGGGTTACACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1075413947 10:122248962-122248984 CCTGCATCCGAGAGTTCCTGGGG 0: 1
1: 0
2: 2
3: 5
4: 127
1075413942_1075413950 8 Left 1075413942 10:122248947-122248969 CCGCCTGGGGTTACACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1075413950 10:122248978-122249000 CCTGGGGTTCCCACCAGTGCTGG 0: 1
1: 0
2: 0
3: 19
4: 288
1075413942_1075413944 -10 Left 1075413942 10:122248947-122248969 CCGCCTGGGGTTACACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1075413944 10:122248960-122248982 CACCTGCATCCGAGAGTTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 206
1075413942_1075413955 24 Left 1075413942 10:122248947-122248969 CCGCCTGGGGTTACACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1075413955 10:122248994-122249016 GTGCTGGGCATTTGTTCTCGTGG 0: 1
1: 0
2: 0
3: 12
4: 143
1075413942_1075413956 25 Left 1075413942 10:122248947-122248969 CCGCCTGGGGTTACACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1075413956 10:122248995-122249017 TGCTGGGCATTTGTTCTCGTGGG 0: 1
1: 0
2: 1
3: 78
4: 3098
1075413942_1075413951 9 Left 1075413942 10:122248947-122248969 CCGCCTGGGGTTACACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1075413951 10:122248979-122249001 CTGGGGTTCCCACCAGTGCTGGG 0: 1
1: 0
2: 3
3: 17
4: 270
1075413942_1075413945 -9 Left 1075413942 10:122248947-122248969 CCGCCTGGGGTTACACCTGCATC 0: 1
1: 0
2: 2
3: 16
4: 170
Right 1075413945 10:122248961-122248983 ACCTGCATCCGAGAGTTCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075413942 Original CRISPR GATGCAGGTGTAACCCCAGG CGG (reversed) Intronic
900812849 1:4821117-4821139 AATGAAGATGTAACCACAGGAGG + Intergenic
902433501 1:16381833-16381855 GAGGCAGGTTTGAACCCAGGAGG + Intronic
912087392 1:106026346-106026368 GATCCAGCTGAAACCCCAAGGGG + Intergenic
912795060 1:112688374-112688396 GGTGCAGGTGGAACCCAAGCAGG - Intronic
913486465 1:119336231-119336253 GATGCAGGTGGTAGCCAAGGTGG - Intergenic
914740946 1:150464520-150464542 GATGCAGGACTGACCCCTGGTGG - Exonic
916234255 1:162570057-162570079 GAGGATGGTGTAAACCCAGGAGG + Intronic
920687037 1:208117290-208117312 GATGCAGGAGGAAACCCAGAGGG + Intronic
924797179 1:247300821-247300843 GCTGCAGGTGTATCCGCCGGTGG + Exonic
1062835083 10:629993-630015 GGTGCAGGTGTGGCCCCCGGGGG - Intronic
1063578879 10:7287502-7287524 GATGCAGGTGTAGCCCAGTGGGG - Intronic
1067278674 10:44855262-44855284 GATGCAGGCATGAGCCCAGGGGG - Intergenic
1069059621 10:63882055-63882077 AATGCAGGTCTATGCCCAGGTGG - Intergenic
1070506261 10:77115894-77115916 GATGCAAGGTTAACCCCTGGTGG + Intronic
1072473314 10:95734227-95734249 GATTCTGGTGTAAGCCAAGGAGG + Intronic
1074320321 10:112395905-112395927 CATGCAGATGTACCCACAGGTGG - Intronic
1075082259 10:119391769-119391791 GATGCAGGTGTTTCTCCAGCGGG + Intronic
1075289482 10:121216025-121216047 GATCAAGGTGTAAGCCCAGTTGG - Intergenic
1075413942 10:122248947-122248969 GATGCAGGTGTAACCCCAGGCGG - Intronic
1076558533 10:131345924-131345946 GACGGAGGTGAAACCCCAGGTGG - Intergenic
1076631209 10:131853302-131853324 GAGGCAGGTGGAGACCCAGGCGG + Intergenic
1078791766 11:14550093-14550115 GATGCAGTCATAACCCCAGAGGG - Intronic
1079386446 11:19984276-19984298 GATGCAGAGGTGATCCCAGGGGG + Intronic
1079627694 11:22635207-22635229 GATGGAGGTGCAAAGCCAGGTGG + Intronic
1081701186 11:45153863-45153885 GATGCGGGAGTAACCTCACGGGG - Intronic
1082809627 11:57471589-57471611 GGTGCAGGTGTGACCCAAGATGG + Intronic
1083205770 11:61148092-61148114 GTTGCAGGAGTAACGCCAGGAGG - Intronic
1084661778 11:70550382-70550404 GCTGCATGCGTACCCCCAGGTGG + Intronic
1085785531 11:79445226-79445248 GATGCAGATGTAACCTCACCAGG - Intergenic
1089518453 11:119048427-119048449 GAGCCAGGTGTAAGCCCAGTGGG + Intronic
1090053420 11:123401207-123401229 GATTCAGCTGTAACCCCAAATGG + Intergenic
1090382800 11:126338698-126338720 GATGCGGGTGGAAGCACAGGTGG - Intronic
1090415126 11:126535229-126535251 GAGGCAGGAGTAAGCGCAGGAGG - Intronic
1091615897 12:2051555-2051577 GATGCTGGTTCAGCCCCAGGTGG + Intronic
1092446192 12:8559573-8559595 GAAGCAGGTGTCTGCCCAGGTGG + Intergenic
1100539525 12:95544452-95544474 GATACAGCTGTAAGCCCTGGAGG + Intronic
1101822013 12:108191602-108191624 GTTGTAGGTGTAAGCCCTGGGGG + Intronic
1102603524 12:114051456-114051478 GTTGCAGGTGAACCTCCAGGTGG - Intergenic
1104803555 12:131570829-131570851 GATGCAGCTGTGGCTCCAGGAGG - Intergenic
1104941402 12:132397212-132397234 GACGCAGGTGAAAGCCCAGGAGG - Intergenic
1104941421 12:132397273-132397295 GACGCAGGTGAAAGCCCAGGAGG - Intergenic
1104941437 12:132397334-132397356 GATGCAGGTGAAAGGCCAGGAGG - Intergenic
1104941455 12:132397395-132397417 GACCCAGGTGAAAGCCCAGGAGG - Intergenic
1104941475 12:132397456-132397478 GATGCAGGTGAAAGCCCAGGAGG - Intergenic
1104941494 12:132397517-132397539 GACGCAGGTGAAAGCCCAGGAGG - Intergenic
1104941509 12:132397574-132397596 GATGCAGGTGAAAGCCCAGGAGG - Intergenic
1104941528 12:132397635-132397657 GACGCAAGTGAAAGCCCAGGAGG - Intergenic
1104941567 12:132397757-132397779 GACACAGGTGAAAGCCCAGGAGG - Intergenic
1104941582 12:132397818-132397840 GACGCAGGTGAAAGCCCAGGAGG - Intergenic
1104941602 12:132397902-132397924 GACGCAGGTGAAAGCCCAGGAGG - Intergenic
1104941619 12:132397963-132397985 GACGCAGGTGAAAGCCCAGGAGG - Intergenic
1114539810 14:23446526-23446548 GATGCATGTGAGAACCCAGGAGG + Intergenic
1114991516 14:28295580-28295602 CTTGAAGGTGAAACCCCAGGGGG - Intergenic
1116292419 14:43060569-43060591 GAGGCAGGCGTTATCCCAGGCGG + Intergenic
1116647914 14:47553046-47553068 GAGGCAGGTCTAACCTGAGGCGG + Intronic
1121996436 14:98606974-98606996 GGTGCAGGTGCAACTCCAAGGGG + Intergenic
1122308634 14:100780917-100780939 GGGGCAGGTGCAACCCCAGAGGG - Intergenic
1122826881 14:104374881-104374903 GAGGCTTGTGCAACCCCAGGAGG + Intergenic
1123017709 14:105383269-105383291 GATGCCAGTGTGAGCCCAGGGGG - Intronic
1123739770 15:23225769-23225791 GCTGCATGTGGACCCCCAGGTGG - Intergenic
1124290995 15:28454742-28454764 GCTGCATGTGGACCCCCAGGTGG - Intergenic
1124383724 15:29189010-29189032 GATGCAGGTGCACAGCCAGGTGG - Intronic
1124594801 15:31083524-31083546 CATGCAGGTGCCACCCCAGGTGG - Intronic
1131149742 15:90039760-90039782 GATGCAGAGGAAACCCAAGGAGG - Intronic
1131290157 15:91100223-91100245 GATGCAGGTGTGACACCCGCCGG + Intronic
1132484452 16:183220-183242 GCTCCAGATGTAATCCCAGGAGG - Intergenic
1132705053 16:1239928-1239950 AGTGCAGGTGCAACCCCAGGAGG - Intergenic
1137247605 16:46718401-46718423 GCTGCTAGTGTAACCGCAGGAGG - Intronic
1137946778 16:52740653-52740675 GATGAAGGTATCACCCCAAGTGG + Intergenic
1138599754 16:58047440-58047462 GGTGCAAGTGATACCCCAGGAGG + Intergenic
1139601401 16:67989642-67989664 GAGGCAGGTTTAATCCTAGGTGG - Intronic
1143164486 17:4891091-4891113 GAGGCCGGTGGAGCCCCAGGAGG + Exonic
1143765392 17:9134400-9134422 GAGGCAGCTGCAACCCCAGCCGG - Intronic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146518110 17:33505175-33505197 TAGGCAGGTGTAACACCAGAGGG + Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150161369 17:62900982-62901004 GCTGCAGGTGGAACCCTGGGAGG + Intergenic
1152614265 17:81330690-81330712 GAGGCAGGCGTGACCCCAGTCGG + Intergenic
1154000122 18:10475719-10475741 GATGCAGGTGGCAGCCCAGCTGG + Intronic
1155495094 18:26435077-26435099 GATGCAAGGGTTACCCAAGGAGG + Intergenic
1158037817 18:53055333-53055355 GACACAGGTGTAAGCCCAAGTGG - Intronic
1160248932 18:77184398-77184420 GATGATGGTGTGAACCCAGGGGG - Intergenic
1167569524 19:50278196-50278218 CCTGCAGCTGTAACTCCAGGCGG - Exonic
925056088 2:858425-858447 GAGGAAAGTGTAACCTCAGGGGG - Intergenic
926292362 2:11541183-11541205 GAAGGAGATGGAACCCCAGGTGG + Intronic
927125790 2:20011933-20011955 GATGCGGGTGTGAGACCAGGAGG - Intronic
927476181 2:23416072-23416094 CATGAAGGTGTAACTCCAGCAGG - Intronic
930242616 2:48952282-48952304 AATGCAGCTGTAACCCCAGAGGG - Intergenic
932617467 2:73243051-73243073 GAAGCAGGTGAAACCCTATGTGG + Exonic
933634591 2:84693644-84693666 GAGGCAGGCGTGAACCCAGGAGG + Intronic
936073051 2:109384153-109384175 GATGAACGTGGGACCCCAGGCGG - Intronic
936502212 2:113075090-113075112 GATGGAGGTGTTAGCCCTGGAGG - Intronic
937603331 2:123767213-123767235 CATGCATGTGCAACCCCAGCTGG - Intergenic
939780100 2:146435518-146435540 GATGCAGATTTGACCACAGGTGG + Intergenic
943165284 2:184315091-184315113 GATGTAGGTGTAAAACCAGGAGG - Intergenic
943438940 2:187901941-187901963 GAGGCAGGAGTGAACCCAGGAGG + Intergenic
945723129 2:213444056-213444078 GATGCACGTGTACTTCCAGGGGG - Intronic
946848892 2:223885841-223885863 GATGCCTGTGTGGCCCCAGGAGG - Intronic
947518524 2:230827634-230827656 GAGGCAGGAGTGAACCCAGGAGG - Intergenic
948920232 2:241062922-241062944 GCTGCAGCTGTCACCCCAGCGGG - Intronic
949032059 2:241802012-241802034 GAGGCAGGTTGAACCTCAGGTGG - Exonic
1169142983 20:3236497-3236519 GAGGCTGGTGTGAACCCAGGAGG + Intronic
1169493247 20:6089286-6089308 GAGCCAGGTGTGGCCCCAGGTGG - Intronic
1170018638 20:11811449-11811471 GAGAAAGGTGTGACCCCAGGAGG - Intergenic
1170053800 20:12176529-12176551 GATGCAGGTGGGGCCCAAGGTGG + Intergenic
1171321108 20:24245213-24245235 GGTGAAGGTGTAAACTCAGGGGG - Intergenic
1173061386 20:39664908-39664930 GATGCAGGTGAACAGCCAGGTGG - Intergenic
1173596305 20:44260762-44260784 GGTGCAAGTGTAGCCCAAGGTGG + Intronic
1174215448 20:48912653-48912675 AATGCAGGTGTGACACCAGCTGG - Intergenic
1175269447 20:57723545-57723567 GAGGCAGGTGGGACCCCAGTGGG + Intergenic
1176274441 20:64255818-64255840 GCTGCAGGTGGCAGCCCAGGCGG + Exonic
1176680487 21:9816714-9816736 TATGAAGATGAAACCCCAGGTGG - Intergenic
1176681055 21:9819526-9819548 TATGAAGATGAAACCCCAGGTGG - Intergenic
1176681904 21:9823763-9823785 TATGAAGATGAAACCCCAGGTGG - Intergenic
1184037143 22:41923716-41923738 GGAGCAGCTGGAACCCCAGGTGG + Intergenic
1184331751 22:43832150-43832172 GATGAAGGTGTAGCCCAAGCAGG - Intronic
1184455727 22:44608578-44608600 GATGCCTGTGGAGCCCCAGGAGG - Intergenic
1184766010 22:46572970-46572992 GAGGCAGGTGTCAGCACAGGAGG + Intergenic
1185250465 22:49799185-49799207 CATGCAGGTGAGACCCCAAGAGG + Intronic
950260474 3:11539863-11539885 GATGCAGGTGAACCTCCAGGCGG - Intronic
951509169 3:23482426-23482448 GGTGGAGGTGTAGCCCCAGCTGG - Intronic
953580972 3:44156307-44156329 GACGCAGATGAAACCCCAAGTGG - Intergenic
954698408 3:52439592-52439614 GATGCAGGAGCAAGCCCAGTAGG - Intronic
955397238 3:58566145-58566167 GCTGCAGGTAAAACCACAGGTGG + Exonic
956245242 3:67175619-67175641 GAGAAAGGTGTAAACCCAGGAGG - Intergenic
958180488 3:90053707-90053729 GCAGCAGGTGCAAGCCCAGGAGG + Intergenic
962673758 3:137736347-137736369 GATGGAGTTTTAATCCCAGGGGG + Intergenic
977903764 4:102452977-102452999 GATGCAGGTTTAACTACAGCGGG + Intergenic
986527218 5:8692829-8692851 GAGGCAGGTGTGAACCCGGGAGG + Intergenic
986964272 5:13251802-13251824 GACGCAGGTCTGACCCCAAGAGG + Intergenic
990442553 5:55861245-55861267 GCCACAGGTGTAACCCCAAGGGG - Intronic
997051318 5:130384387-130384409 AATGCAGATGTGACCACAGGAGG + Intergenic
997872011 5:137514632-137514654 CCTGCAAGTGTAACCCCAGAAGG - Intronic
1000395855 5:160774139-160774161 GTTTCCAGTGTAACCCCAGGAGG + Intronic
1002846193 6:947430-947452 CTTGCAGGTGGAAGCCCAGGAGG + Intergenic
1003405189 6:5822080-5822102 GATGCTGCTGGAACCCCAGCAGG + Intergenic
1006775909 6:36592436-36592458 GATGCAGGTGTGACCACAATTGG + Intergenic
1008808274 6:55458394-55458416 GATGCATGTGTGACTCAAGGTGG + Intronic
1011655457 6:89547473-89547495 GAGGCAGGTGACACCCCCGGAGG - Intronic
1011735013 6:90301928-90301950 GATGAAAGTGTAACCTCAAGGGG - Intergenic
1016993957 6:149947896-149947918 GATCTGGGTGTAATCCCAGGAGG + Intronic
1017004376 6:150019641-150019663 GATCTGGGTGTAATCCCAGGAGG - Intronic
1017151944 6:151288420-151288442 GAGGCAGGTTGAACCCCGGGAGG + Intronic
1017785848 6:157756744-157756766 GACGCAGGCGGATCCCCAGGCGG + Intronic
1018765740 6:166931720-166931742 GATGCAGGTGTCCTCCTAGGAGG - Intronic
1019319642 7:409770-409792 GCTGCAGGTGGCATCCCAGGAGG + Intergenic
1020012935 7:4816297-4816319 GCTGCAGGTGCACCCCGAGGTGG - Exonic
1021792393 7:24218557-24218579 GATGCAGAGGAAACCCAAGGAGG + Intergenic
1029419573 7:100465944-100465966 GCTGCAGCTGTAGCCCCAGGAGG - Intronic
1036211258 8:6842994-6843016 GATGCAGGGGTAAGCCCGGTGGG + Intergenic
1036717948 8:11144318-11144340 GAAGCGGGTATAACCCCAGAAGG + Intronic
1041705159 8:60838845-60838867 AATGCAGGTGAAACCTCAGAAGG - Intronic
1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG + Intronic
1047384349 8:124395578-124395600 GGTGGAGGGGTAACGCCAGGTGG + Intergenic
1048860812 8:138723445-138723467 GATGCAGCTGTAGCCACAGAAGG - Intronic
1051188544 9:14486361-14486383 GAGGCAGGAGAAAGCCCAGGAGG + Intergenic
1056792208 9:89633234-89633256 GTGGCAGGTGGACCCCCAGGAGG - Intergenic
1057274924 9:93671087-93671109 GGTGCAGGTGTAGACGCAGGTGG + Intronic
1057801659 9:98194924-98194946 GATGCAGGTGCAAGCCTTGGAGG - Intergenic
1058101054 9:100917932-100917954 GAGGCAGGAGTTACCACAGGAGG - Intergenic
1058346938 9:103975594-103975616 GATGCAGTTGGAACACAAGGAGG - Intergenic
1061150065 9:128823381-128823403 GATGCAAGTGAGACCCCAAGGGG + Intronic
1061528442 9:131189077-131189099 GATGCTGGTGTAGGCCCAGATGG - Exonic
1062112371 9:134789070-134789092 CATGCAGGTGGTCCCCCAGGCGG + Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062262757 9:135671111-135671133 GAGGCAGGCGAAGCCCCAGGAGG + Intergenic
1203665366 Un_KI270754v1:17837-17859 TATGAAGATGAAACCCCAGGTGG - Intergenic
1203666513 Un_KI270754v1:23473-23495 TATGAAGATGAAACCCCAGGTGG - Intergenic
1203667662 Un_KI270754v1:29112-29134 TATGAAGATGAAACCCCAGGTGG - Intergenic
1203669083 Un_KI270754v1:36161-36183 TATGAAGATGAAACCCCAGGTGG - Intergenic
1203669653 Un_KI270754v1:38977-38999 TATGAAGATGAAACCCCAGGTGG - Intergenic
1185962933 X:4565320-4565342 TATGCAAATGTAACACCAGGAGG - Intergenic
1187051758 X:15702975-15702997 GATGCGGGTGTAGTCCCAGCTGG - Intronic
1189478696 X:41376604-41376626 GGTGCAGGTGTAACCAATGGTGG + Intergenic
1198392593 X:136191246-136191268 AATGCAGGAGTAACCACAGGTGG - Intronic
1199722937 X:150555749-150555771 GAGGCTGGTGTGAACCCAGGAGG + Intergenic