ID: 1075414608

View in Genome Browser
Species Human (GRCh38)
Location 10:122253131-122253153
Sequence TCACCAAAAGCCTGTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075414608_1075414610 -5 Left 1075414608 10:122253131-122253153 CCTCAGGGACAGGCTTTTGGTGA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1075414610 10:122253149-122253171 GGTGAAGACTGATCTTCCATGGG No data
1075414608_1075414613 14 Left 1075414608 10:122253131-122253153 CCTCAGGGACAGGCTTTTGGTGA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1075414613 10:122253168-122253190 TGGGAATCTCAAGGAAAAGCTGG No data
1075414608_1075414609 -6 Left 1075414608 10:122253131-122253153 CCTCAGGGACAGGCTTTTGGTGA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1075414609 10:122253148-122253170 TGGTGAAGACTGATCTTCCATGG No data
1075414608_1075414611 5 Left 1075414608 10:122253131-122253153 CCTCAGGGACAGGCTTTTGGTGA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1075414611 10:122253159-122253181 GATCTTCCATGGGAATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075414608 Original CRISPR TCACCAAAAGCCTGTCCCTG AGG (reversed) Intronic
900118405 1:1038370-1038392 TCACTCAGAGCCTGTCCCTAAGG + Intronic
900554325 1:3272223-3272245 TCACCACACGCCTGTCCCCGTGG - Intronic
900786301 1:4652862-4652884 TCCCCTAGAGCCTCTCCCTGAGG - Intergenic
900881968 1:5388727-5388749 TCCCTTGAAGCCTGTCCCTGGGG - Intergenic
902661851 1:17909869-17909891 CCACCAGAAGCCAGTCCCCGTGG + Intergenic
902839430 1:19065896-19065918 TCACCAAGAGCCTGGCACAGAGG - Intergenic
903017732 1:20372233-20372255 GCACCAAACACCTGTCTCTGAGG - Intergenic
904408600 1:30311374-30311396 CCACCAAGAGCTTGGCCCTGTGG - Intergenic
905206031 1:36343306-36343328 CCCCCAGAAGCCTGTCCCTTGGG + Intronic
905942427 1:41874799-41874821 TCTCCAAGTGCCAGTCCCTGAGG + Intronic
906674638 1:47684360-47684382 TGACCACAAGCATGTCCTTGGGG + Intergenic
907242780 1:53090025-53090047 GCACCAAATGGCTGTCCCAGAGG - Intronic
907841782 1:58165280-58165302 TCACCAAGTGCCTGGCCCGGAGG + Intronic
909554651 1:76940087-76940109 TCACTAAAAGCTTGTACTTGAGG + Intronic
909814433 1:79974389-79974411 TCAGGAAAATCCTCTCCCTGGGG - Intergenic
911064374 1:93774601-93774623 TCACCCAAGCCCTGTCCCTATGG + Intronic
912175244 1:107147551-107147573 TTGGCATAAGCCTGTCCCTGTGG - Intronic
912358759 1:109076920-109076942 TGACCAAAAGCCTTCCCCGGTGG - Intergenic
913533927 1:119753580-119753602 TACACAAAGGCCTGTCCCTGGGG - Intronic
914045093 1:144084651-144084673 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
914133017 1:144876035-144876057 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
915738429 1:158099384-158099406 TCACAAAAAGCCTGGCCTTGAGG - Intronic
919024751 1:192152670-192152692 TCACCAGAATCCAGACCCTGGGG - Intergenic
920446971 1:206024990-206025012 TCACCATCAGCCTATCTCTGTGG + Intergenic
924849240 1:247808291-247808313 TCACCAGTGGGCTGTCCCTGAGG - Intergenic
1065274391 10:24070885-24070907 TCACTAAAAGCTTGTCTCTGTGG + Intronic
1065963822 10:30754820-30754842 TCACCATCAGCCAGTTCCTGGGG + Intergenic
1067036952 10:42927846-42927868 TCTCCACCAGCCTGTCCCAGAGG + Intergenic
1067395233 10:45909629-45909651 TCACCCAGAGCCTGCCTCTGAGG - Intergenic
1067863555 10:49878753-49878775 TCACCCAGAGCCTGCCTCTGAGG - Intronic
1069162643 10:65109952-65109974 TCCACCACAGCCTGTCCCTGAGG + Intergenic
1070716444 10:78725641-78725663 TTACCAAAACCCTGTCATTGTGG + Intergenic
1072810452 10:98457492-98457514 TCCCTAAGAGCCTGGCCCTGGGG - Intronic
1074122562 10:110503918-110503940 TGAACAAAACCCTGTCCCTGGGG + Intronic
1074610204 10:115014527-115014549 TCCCACAAAACCTGTCCCTGGGG - Intergenic
1075372453 10:121949536-121949558 TCATAAAAAGCTTATCCCTGAGG + Intergenic
1075414608 10:122253131-122253153 TCACCAAAAGCCTGTCCCTGAGG - Intronic
1076256125 10:129025989-129026011 TCCTCAACAGCCTGTCCCCGAGG - Intergenic
1076730944 10:132438592-132438614 TCCCCAAATGCCCGTCTCTGAGG - Intergenic
1077739505 11:4829815-4829837 TCAACATAAGCCAGTCACTGAGG - Intronic
1077993903 11:7436345-7436367 CCACCAAATTCCTTTCCCTGTGG - Intronic
1079162667 11:18009356-18009378 TCTCCAAAAGGCAGTACCTGGGG - Intronic
1082309840 11:50633041-50633063 TCCACCACAGCCTGTCCCTGAGG + Intergenic
1084543493 11:69801688-69801710 ACACCTGAAGCTTGTCCCTGAGG + Intergenic
1085039059 11:73316348-73316370 AAAACAAAAGCCTGTCCTTGTGG + Intronic
1086093460 11:83027082-83027104 ACTCCAAAGGCCTGTCTCTGGGG + Intronic
1087680612 11:101215006-101215028 TCCACCACAGCCTGTCCCTGAGG + Intergenic
1088091457 11:106044853-106044875 TCAAGAAAAGCCTTTCCCTGTGG - Intergenic
1094865635 12:34527398-34527420 TCCACCACAGCCTGTCCCTGAGG - Intergenic
1095228896 12:39710676-39710698 TCACCAAACCTCTTTCCCTGGGG + Intronic
1096131237 12:49160539-49160561 TCAGTAAAAGCCTGACACTGTGG + Intergenic
1097371348 12:58785423-58785445 CCAGTAAAAGCCTTTCCCTGTGG - Intronic
1098410496 12:70177759-70177781 TCACCAAAAGACTTTCACTGAGG + Intergenic
1098912244 12:76221233-76221255 TCAGAGAAAGCTTGTCCCTGTGG + Intergenic
1099555445 12:84103805-84103827 TCCACCACAGCCTGTCCCTGAGG + Intergenic
1100153039 12:91764582-91764604 TCACCAAAATCCTTTCTCTGGGG - Intergenic
1101501774 12:105310881-105310903 TCCACCACAGCCTGTCCCTGAGG - Intronic
1102156058 12:110728997-110729019 TCAGCAAAGGGTTGTCCCTGTGG - Intronic
1102683564 12:114706667-114706689 CCTCCAAATGCCTGTCCCAGCGG - Intergenic
1104604661 12:130179347-130179369 ACAGCAAAAACCTGTCCCTCTGG + Intergenic
1106540520 13:30686270-30686292 TCACTTAAAGCCTGGCCCTCAGG + Intergenic
1107709620 13:43138910-43138932 TCAGCCAATGTCTGTCCCTGAGG - Intergenic
1112302251 13:98240818-98240840 TCCCCGAAAGCCCTTCCCTGAGG - Intronic
1117910416 14:60632862-60632884 TCACCAAAAGCATTTCCCGTAGG + Intergenic
1119202856 14:72771331-72771353 TCACCAAACTTCTGTCCCTCAGG - Intronic
1120023023 14:79551671-79551693 TGTTCAAAAGCCAGTCCCTGGGG - Intronic
1120956983 14:90091562-90091584 TGCCCAAAAGCCTGTTTCTGGGG + Intronic
1121247636 14:92473814-92473836 TCAATCAGAGCCTGTCCCTGAGG - Intronic
1121983314 14:98474405-98474427 TCAGCATTGGCCTGTCCCTGTGG + Intergenic
1121985566 14:98502010-98502032 TCTTCAAAAGCCTGGCCATGGGG - Intergenic
1122435322 14:101691356-101691378 TCACCTAAAGCCCATTCCTGAGG + Intergenic
1125416718 15:39461405-39461427 TCACAAAAACTATGTCCCTGAGG + Intergenic
1127384338 15:58454748-58454770 TCACCAAACCCCAGGCCCTGGGG - Intronic
1127944454 15:63736383-63736405 TCACCAGAAGACTGTCACTCAGG + Intronic
1128932057 15:71714169-71714191 TCCACAAAACCCTGTCCCAGAGG + Intronic
1129100325 15:73256158-73256180 TCTCAAGAACCCTGTCCCTGGGG - Intronic
1132025214 15:98399379-98399401 TCATCACAAGCATGTGCCTGCGG - Intergenic
1132228391 15:100161861-100161883 GCATCAAAAGCCTCTCACTGCGG + Intronic
1134414563 16:14032316-14032338 TCTCCAAAACCCTGTCCTTTGGG - Intergenic
1134462824 16:14444576-14444598 AAACGAAAAGCTTGTCCCTGAGG + Intronic
1138608134 16:58101865-58101887 TCTCCACATGCCTCTCCCTGTGG + Intergenic
1139270660 16:65679797-65679819 TCACCAAAATCCTGCCATTGGGG - Intergenic
1139692888 16:68652288-68652310 TCACCAGTAGCTTGTGCCTGGGG + Intronic
1140309964 16:73839827-73839849 TCACCCTAACCCTATCCCTGGGG + Intergenic
1142779681 17:2171825-2171847 TCCCCAAAGGCCTGTCCCCAGGG + Intronic
1143889041 17:10088314-10088336 TCACCCATGGCCTGTCCCAGTGG - Intronic
1144316148 17:14063296-14063318 TCTCCAAAAGCCTGACTCTCAGG + Intergenic
1144763439 17:17720379-17720401 TCACCAAGAGTCTGCCCCAGGGG - Intronic
1148341569 17:46876453-46876475 TCACCAAAGGCCTGGCCCCAAGG + Exonic
1150230876 17:63549870-63549892 GCGCCCGAAGCCTGTCCCTGAGG + Intergenic
1152078991 17:78174955-78174977 TCACCCATCCCCTGTCCCTGCGG - Intronic
1152139418 17:78527631-78527653 CCACCACAATCCTGCCCCTGGGG + Intronic
1152733920 17:81987481-81987503 TCACCAAGCACCTGTGCCTGTGG - Intronic
1153512981 18:5875745-5875767 TCCCCAAAATCTTGTCACTGAGG - Intergenic
1155171982 18:23273752-23273774 CCACCTAAAGCCAGTCACTGTGG + Intronic
1160541560 18:79626704-79626726 TCCCCAAATCCCTGTACCTGGGG - Intergenic
1160922993 19:1529341-1529363 CCACCTCACGCCTGTCCCTGGGG + Intronic
1162302759 19:9853562-9853584 TCCCCAAAGGGCTGGCCCTGGGG + Intergenic
1164289074 19:23850920-23850942 TCCACAACAGCCTGTCCCTGAGG + Intergenic
1164378067 19:27706988-27707010 TCCACCACAGCCTGTCCCTGAGG + Intergenic
1166665490 19:44677489-44677511 TCACGAATAGACTCTCCCTGGGG - Intronic
1167260836 19:48456708-48456730 TTACCAAACGCTTGGCCCTGTGG - Exonic
1202684651 1_KI270712v1_random:38055-38077 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
925899048 2:8495479-8495501 TCACCACAAGACGGTACCTGGGG - Intergenic
926401568 2:12502522-12502544 TCAACCAAAGTCTCTCCCTGAGG + Intergenic
927861244 2:26561605-26561627 TCACCAAGAGCCTGGCACCGTGG + Intergenic
931815931 2:65900610-65900632 TCCCTAAAAGTCTGTCCCTCTGG + Intergenic
932128606 2:69167630-69167652 GCACCGAAAGCTTGCCCCTGGGG - Intronic
933976613 2:87517195-87517217 TCAGTAAAAGTCTGACCCTGTGG + Intergenic
934247066 2:90316791-90316813 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
934262260 2:91485812-91485834 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
934305310 2:91816799-91816821 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
934327947 2:92035949-92035971 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
934466335 2:94266488-94266510 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
934817172 2:97337825-97337847 GCACCAGCAGCCTGGCCCTGTGG - Intergenic
934820524 2:97370659-97370681 GCACCAGCAGCCTGGCCCTGTGG + Intergenic
935142459 2:100365403-100365425 TCCACCACAGCCTGTCCCTGAGG + Intergenic
935737345 2:106116827-106116849 TCAATAAAAGCCTGACCTTGTGG + Intronic
936317206 2:111433609-111433631 TCAGTAAAAGTCTGACCCTGTGG - Intergenic
938270374 2:129965023-129965045 TCAACTATGGCCTGTCCCTGGGG + Intergenic
939256619 2:139751833-139751855 TCACCAGGGGCATGTCCCTGGGG - Intergenic
939464901 2:142544554-142544576 TCACCAAAAGCCAATCTCTGAGG - Intergenic
944654651 2:201865411-201865433 TCCGCTAAAGCCTGTTCCTGAGG - Intronic
948202011 2:236136182-236136204 TCACCACAGGCCTTTCCTTGTGG + Intergenic
948223794 2:236293377-236293399 TGACCAGAAGCCTGTCCCCAGGG + Intergenic
948587519 2:239028457-239028479 TCATCAGAAGGCTGTCCTTGGGG + Intergenic
948782159 2:240328551-240328573 ACACCAAAAGCGTGTGCTTGTGG + Intergenic
1171231870 20:23493364-23493386 TCACCAAAAGCCTGTCCTCTTGG + Intronic
1172743262 20:37185952-37185974 TCAGCAAAATCCAGTTCCTGTGG + Intronic
1174655805 20:52171231-52171253 TTACCATAAGCCTTTCCCTGGGG - Intronic
1174842961 20:53917011-53917033 TCGCAACAAGCCTGTTCCTGGGG - Intergenic
1176120290 20:63451521-63451543 TCAATAAAAGCCTGACCCTGTGG + Intronic
1178660836 21:34506220-34506242 TTTCCAAAAGCTTGTCCCCGTGG - Intergenic
1180587457 22:16905659-16905681 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1181052926 22:20246242-20246264 TGACCCAGAGCCTCTCCCTGCGG + Intronic
1181461238 22:23087069-23087091 TCTGGAAAAGCCTGTGCCTGTGG - Intronic
1181730873 22:24845468-24845490 ACAGCAAAAGCCTGGCCATGGGG - Intronic
1182008860 22:26983736-26983758 TCACCCTAGTCCTGTCCCTGAGG - Intergenic
1182833900 22:33325960-33325982 TAACCCAGAGCTTGTCCCTGTGG + Intronic
1184314193 22:43670912-43670934 TCACCATATGCTTGGCCCTGAGG + Intronic
1184967836 22:47994375-47994397 TCAGCCAGAGCCTGTGCCTGGGG - Intergenic
952991995 3:38838143-38838165 TAACAAAAAGCCTGCCCTTGAGG - Intergenic
953475262 3:43200574-43200596 TCTTCAAGAGCCTCTCCCTGTGG - Intergenic
954372196 3:50174766-50174788 TCCCCACAACCCTGGCCCTGGGG - Intronic
956778727 3:72587789-72587811 GCCCCGAATGCCTGTCCCTGTGG - Intergenic
957002443 3:74901780-74901802 TCACCAAAATCTTGTTCCAGAGG + Intergenic
961922955 3:130447025-130447047 TCCACCACAGCCTGTCCCTGAGG + Intronic
964444444 3:156744085-156744107 TCACCAGAAGCCTCTTCATGCGG + Intergenic
964720811 3:159765477-159765499 GCACCAAAAGTCAGTGCCTGCGG + Intronic
965556020 3:170019178-170019200 TCACCCAAAGGCTGTCACTGTGG + Intergenic
966218296 3:177525252-177525274 TGACCATAAGCCTGTTCTTGAGG + Intergenic
969498367 4:7539179-7539201 ACACCAAAAGCCTGTGCTTTGGG + Intronic
969925794 4:10584603-10584625 TCACCATAAGACTGGCACTGAGG + Intronic
971642356 4:29151762-29151784 TCATCACAAGCCTTTCCTTGGGG + Intergenic
973264132 4:48194141-48194163 TCTCCTAAAGCCTTCCCCTGGGG + Intronic
973372524 4:49263239-49263261 TCACGATAAGTCTGGCCCTGAGG - Intergenic
976482278 4:85558248-85558270 TATCCAAGAGCCTGTCTCTGAGG - Intronic
979138076 4:117135829-117135851 TCACCAAATGCCTGATGCTGAGG - Intergenic
982609961 4:157560365-157560387 TCACCATTACCCTGTCCCCGGGG + Intergenic
984014214 4:174406733-174406755 TCACCAAATGCACATCCCTGTGG - Intergenic
984833244 4:183995795-183995817 TCACCACCAGCCTGCCCCAGGGG + Intronic
985833280 5:2251667-2251689 TCTCCAAATGCCCTTCCCTGGGG + Intergenic
987914522 5:24194397-24194419 TTACCAAAAGAATATCCCTGAGG - Intergenic
988615509 5:32771169-32771191 TCAAGAAAAGCCGGTCTCTGGGG + Intronic
990246621 5:53869597-53869619 TCCCCATCAACCTGTCCCTGAGG + Intergenic
998160385 5:139809670-139809692 TCACCAATGGCCTAGCCCTGGGG + Exonic
998205195 5:140152706-140152728 TCACCAAAGTCCTGGTCCTGAGG - Intergenic
1005364306 6:25061791-25061813 TCTCCAAAAGCCTCTCTCTGTGG - Intergenic
1005758119 6:28943784-28943806 TCACCATAAGCCCTTCCCTCAGG + Intergenic
1006618539 6:35346202-35346224 TCAGCTATATCCTGTCCCTGAGG + Intronic
1006654019 6:35575153-35575175 CCACACACAGCCTGTCCCTGGGG - Exonic
1007181983 6:39935418-39935440 TATCCAAAACCCTGTCCCTGTGG + Intergenic
1007231025 6:40347871-40347893 TCCCCACAGGCCTGTCACTGCGG + Intergenic
1007652515 6:43432318-43432340 TCAGCCACAGCCTGGCCCTGTGG + Exonic
1007924827 6:45642580-45642602 TCATCACAAGTCTGGCCCTGCGG - Intronic
1010492268 6:76490372-76490394 TCCACCACAGCCTGTCCCTGAGG + Intergenic
1011357901 6:86491479-86491501 CCAACAAAAGGCTCTCCCTGAGG + Intergenic
1014000751 6:116363626-116363648 TAACTAAATGCCTGTCCTTGAGG - Intronic
1015670767 6:135687327-135687349 TCACCCAATGCCTCTCCCTGAGG + Intergenic
1015792319 6:136976013-136976035 TCACCTGAAGCATGACCCTGAGG + Intergenic
1016727060 6:147383926-147383948 CCACCACAAGCCTGTATCTGAGG - Intronic
1017061138 6:150486126-150486148 TGAACAAAAGAGTGTCCCTGGGG - Intergenic
1017657669 6:156645579-156645601 CCACCAATAGCCTGGTCCTGGGG + Intergenic
1019687429 7:2389315-2389337 TCACAGAAAGCCCGTCCCAGGGG + Intergenic
1021215566 7:17912175-17912197 TCAGCCAAATGCTGTCCCTGGGG - Intronic
1022386530 7:29904479-29904501 CCACCAAATGGCTTTCCCTGAGG - Intronic
1023862012 7:44222330-44222352 TCACCAGAAGGCAGGCCCTGTGG + Intronic
1024306561 7:47934263-47934285 TCAATAAAAGCCTGACACTGTGG + Intronic
1024454134 7:49583512-49583534 TCACTAAAAGTCTGACCTTGTGG + Intergenic
1027729994 7:81859232-81859254 GCACCAAAAGCTAGTTCCTGAGG + Intergenic
1030192027 7:106819757-106819779 TCAACAAAAGCCTGACAGTGTGG + Intergenic
1032713679 7:134485851-134485873 TCAATAAAAGCCTGACACTGTGG + Intergenic
1034478112 7:151300416-151300438 CCACCAAAAGCGGGGCCCTGAGG - Intergenic
1035906165 8:3512393-3512415 GCACCAAAAGCCTGTCTATGGGG - Intronic
1037539089 8:19854897-19854919 TCACCAAATGCAGGTTCCTGGGG + Intergenic
1037700069 8:21265590-21265612 TCACCTAAAGAATGGCCCTGTGG + Intergenic
1038772896 8:30500601-30500623 TCTCCAAATTCCTGTCACTGAGG - Intronic
1044720225 8:95138111-95138133 TCACCAAAAGCGTGACTTTGGGG - Intronic
1048440730 8:134457454-134457476 TCACTAAAAGCTGGTCCCAGGGG - Intergenic
1050795479 9:9535501-9535523 TCACCAAAACTCTATCCCAGAGG + Intronic
1053337123 9:37285510-37285532 TCCCCAAAAGCCTGCTCCTAAGG - Intronic
1053577289 9:39365340-39365362 TCACCAGGAGCCTGGCACTGAGG + Intergenic
1053696383 9:40643259-40643281 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1053841789 9:42193265-42193287 TCACCAGGAGCCTGGCACTGAGG + Intergenic
1054098860 9:60924030-60924052 TCACCAGGAGCCTGGCACTGAGG + Intergenic
1054120258 9:61199651-61199673 TCACCAGGAGCCTGGCACTGAGG + Intergenic
1054307634 9:63442487-63442509 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1054406361 9:64766489-64766511 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1054439988 9:65251962-65251984 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1054490417 9:65769977-65769999 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
1054587494 9:66982903-66982925 TCACCAGGAGCCTGGCACTGAGG - Intergenic
1055376308 9:75651501-75651523 CCATCAACAGCCTGTCCCAGAGG - Intergenic
1055927040 9:81521141-81521163 TCAGCAGAAGATTGTCCCTGGGG - Intergenic
1055977430 9:81968713-81968735 TCACCAGAGACCTGTCTCTGGGG + Intergenic
1057522294 9:95769635-95769657 CCACCAAAAACCAGTCACTGAGG - Intergenic
1060882965 9:127131434-127131456 TCACCACATGCCTGGCACTGGGG + Intronic
1061886106 9:133591814-133591836 TCACCCTAGGCCTGTCCGTGTGG + Intergenic
1202778831 9_KI270717v1_random:16920-16942 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1203552979 Un_KI270743v1:179758-179780 TCACGATAAGTCTGGCCCTGAGG + Intergenic
1203585906 Un_KI270747v1:3328-3350 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1186403533 X:9281359-9281381 TCCCCAAAGGCCTGGCCATGTGG + Intergenic
1186536309 X:10352430-10352452 TAACCCAAAACCTGTCCCAGGGG - Intergenic
1190932776 X:54963594-54963616 TAAGCAAATGCCTGTTCCTGTGG - Intronic
1191125161 X:56946670-56946692 TCCACCACAGCCTGTCCCTGAGG - Intergenic
1191615166 X:63162726-63162748 TCACCCAATGACTCTCCCTGGGG + Intergenic
1191621132 X:63216197-63216219 TCACCCAATGACTCTCCCTGGGG - Intergenic
1194817090 X:98455695-98455717 TTACCAAATGCCTCTCCATGGGG + Intergenic
1194962150 X:100248091-100248113 CCTTCAAAAGCCTGTCACTGTGG - Intergenic
1196235050 X:113269934-113269956 TCACCAAAAGCCCTTTTCTGGGG - Intergenic
1199700425 X:150371429-150371451 TCAGCAGAAAACTGTCCCTGTGG - Intronic
1201194129 Y:11475192-11475214 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1201475551 Y:14377443-14377465 TCCACCACAGCCTGTCCCTGAGG + Intergenic