ID: 1075414613

View in Genome Browser
Species Human (GRCh38)
Location 10:122253168-122253190
Sequence TGGGAATCTCAAGGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075414608_1075414613 14 Left 1075414608 10:122253131-122253153 CCTCAGGGACAGGCTTTTGGTGA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1075414613 10:122253168-122253190 TGGGAATCTCAAGGAAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075414613 Original CRISPR TGGGAATCTCAAGGAAAAGC TGG Intronic
No off target data available for this crispr