ID: 1075414820

View in Genome Browser
Species Human (GRCh38)
Location 10:122254999-122255021
Sequence CAATGAAGCGATCTCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075414820_1075414826 10 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414826 10:122255032-122255054 GCTCAGGGTTCCCAGGTTGAAGG No data
1075414820_1075414828 14 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414828 10:122255036-122255058 AGGGTTCCCAGGTTGAAGGGTGG No data
1075414820_1075414825 3 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414825 10:122255025-122255047 CCGACTTGCTCAGGGTTCCCAGG No data
1075414820_1075414827 11 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414827 10:122255033-122255055 CTCAGGGTTCCCAGGTTGAAGGG No data
1075414820_1075414830 18 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414830 10:122255040-122255062 TTCCCAGGTTGAAGGGTGGGTGG No data
1075414820_1075414829 15 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414829 10:122255037-122255059 GGGTTCCCAGGTTGAAGGGTGGG No data
1075414820_1075414823 -5 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414823 10:122255017-122255039 CATTGCTGCCGACTTGCTCAGGG No data
1075414820_1075414833 24 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414833 10:122255046-122255068 GGTTGAAGGGTGGGTGGATGAGG No data
1075414820_1075414822 -6 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414822 10:122255016-122255038 TCATTGCTGCCGACTTGCTCAGG No data
1075414820_1075414834 25 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414834 10:122255047-122255069 GTTGAAGGGTGGGTGGATGAGGG No data
1075414820_1075414835 26 Left 1075414820 10:122254999-122255021 CCTGGCCTGAGATCGCTTCATTG No data
Right 1075414835 10:122255048-122255070 TTGAAGGGTGGGTGGATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075414820 Original CRISPR CAATGAAGCGATCTCAGGCC AGG (reversed) Intergenic