ID: 1075418266

View in Genome Browser
Species Human (GRCh38)
Location 10:122281707-122281729
Sequence ACCAAGAAGCAGAAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075418262_1075418266 -10 Left 1075418262 10:122281694-122281716 CCCTTCCTCTGGGACCAAGAAGC 0: 1
1: 0
2: 1
3: 20
4: 193
Right 1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG No data
1075418258_1075418266 14 Left 1075418258 10:122281670-122281692 CCAAACATTCACTCTTTCACTCC 0: 1
1: 0
2: 1
3: 32
4: 391
Right 1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG No data
1075418257_1075418266 28 Left 1075418257 10:122281656-122281678 CCTTGCAAGTTATTCCAAACATT 0: 1
1: 0
2: 0
3: 14
4: 200
Right 1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG No data
1075418261_1075418266 -7 Left 1075418261 10:122281691-122281713 CCTCCCTTCCTCTGGGACCAAGA 0: 1
1: 0
2: 1
3: 23
4: 270
Right 1075418266 10:122281707-122281729 ACCAAGAAGCAGAAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075418266 Original CRISPR ACCAAGAAGCAGAAAATGGA AGG Intronic
No off target data available for this crispr