ID: 1075419005

View in Genome Browser
Species Human (GRCh38)
Location 10:122287058-122287080
Sequence CAGGCTCAGGCTCAGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 1, 2: 7, 3: 81, 4: 768}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075419005_1075419016 1 Left 1075419005 10:122287058-122287080 CCCCCTCCCTGAGCCTGAGCCTG 0: 1
1: 1
2: 7
3: 81
4: 768
Right 1075419016 10:122287082-122287104 AGGGAGAGCCCCACTGCCTGCGG No data
1075419005_1075419017 2 Left 1075419005 10:122287058-122287080 CCCCCTCCCTGAGCCTGAGCCTG 0: 1
1: 1
2: 7
3: 81
4: 768
Right 1075419017 10:122287083-122287105 GGGAGAGCCCCACTGCCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075419005 Original CRISPR CAGGCTCAGGCTCAGGGAGG GGG (reversed) Intronic
900149366 1:1171460-1171482 CTGCCTCAGCCTCAGGGAGGAGG + Intergenic
900158159 1:1211798-1211820 CAGGCCCAGGCCCAGGATGGCGG + Exonic
900225820 1:1533251-1533273 CAGGGTCAGGGTCAGGGTGTGGG - Intronic
900290897 1:1923174-1923196 CAGGGTCAGGCTGAGGCATGGGG + Intronic
900317016 1:2061961-2061983 CAGGCTGAGGGTCAGTGAGAAGG + Intronic
900401276 1:2473930-2473952 CTGGCTCAGGCTCACGGGAGGGG + Intronic
900463150 1:2810887-2810909 CTGGCTCACGCTCTGGGAGGAGG + Intergenic
900578021 1:3393948-3393970 CAGGTCCAGGGCCAGGGAGGGGG + Intronic
900704575 1:4072249-4072271 GAGACTGAGGCTCAGAGAGGAGG + Intergenic
900770945 1:4543616-4543638 CAGGCACAGGTGCAGGTAGGTGG - Intergenic
900777303 1:4594641-4594663 CACGCCCAGGCTCAGTGGGGAGG + Intergenic
900926433 1:5709183-5709205 CAGGCTCAGGTTGGGGCAGGTGG + Intergenic
901258761 1:7855935-7855957 AAGGCTGAGGCTGAGGCAGGAGG - Intergenic
901459269 1:9382095-9382117 GAGGCCCAGGCCAAGGGAGGAGG + Intergenic
901681711 1:10916544-10916566 TGGGCCCAGGGTCAGGGAGGAGG + Intergenic
901875503 1:12165031-12165053 CAGGGTCAGGCCCAGGGGTGAGG - Intergenic
902279427 1:15363476-15363498 GAAGCTAAGGCTCAGTGAGGTGG - Intronic
902300790 1:15501217-15501239 ACGGCTCAGCCTCAGAGAGGTGG + Intronic
902311871 1:15587242-15587264 CAGGATCAGAGACAGGGAGGTGG - Intronic
902492771 1:16797255-16797277 AAGCCTCAGGATCAGTGAGGAGG - Intronic
902625555 1:17674206-17674228 AAGGCTCAGGGTCAGGCAGAAGG - Intronic
902799716 1:18821631-18821653 GAGACTGAGGCCCAGGGAGGAGG + Intergenic
903220221 1:21865221-21865243 CAGGCTCTGAGTCAGGGTGGAGG + Intronic
903225848 1:21893963-21893985 CAGGATGAGGCAGAGGGAGGAGG + Intronic
903280542 1:22247589-22247611 CAGACTCGGGCTCAGGCAGTGGG - Intergenic
903465614 1:23550657-23550679 AAACCTGAGGCTCAGGGAGGTGG + Intergenic
904081650 1:27876205-27876227 CAAAATCAGGCTCAGAGAGGGGG + Intronic
904082836 1:27882733-27882755 CAGCCGCAGGCCCAGGAAGGAGG - Exonic
904401402 1:30259013-30259035 CAGGCTGAGACTCTGGCAGGGGG + Intergenic
904455289 1:30644116-30644138 CAGGGTTAGGCTCTGGCAGGTGG + Intergenic
904890265 1:33774339-33774361 TTTGCTCAGGCTCAGGGATGGGG + Intronic
905586075 1:39119680-39119702 CAGGTCCAGGAGCAGGGAGGGGG - Intronic
905961360 1:42045124-42045146 CAGGCTCAAGATCATGGAGATGG + Intergenic
906319742 1:44808608-44808630 CAGGAACAGACACAGGGAGGGGG - Exonic
906460103 1:46030313-46030335 CTGGGGCAGGCTCAGGGAGTTGG + Intronic
906677239 1:47701964-47701986 GAGGCTGGGGGTCAGGGAGGAGG - Intergenic
907310660 1:53537180-53537202 CAAGCTCTGGCTTGGGGAGGGGG + Intronic
907310717 1:53537501-53537523 CAGGTTCAGGCTCCCGGTGGTGG - Intronic
908382008 1:63605683-63605705 CAGGCTGAGGCTCAGGTGGGAGG - Intronic
908703923 1:66930416-66930438 CCGGCTCCGGGACAGGGAGGGGG - Intronic
909602373 1:77473949-77473971 CTGGCAAAGGCTCAGGGAGGAGG + Intronic
910434518 1:87191624-87191646 CAGGCACAGTGACAGGGAGGAGG + Intergenic
910863364 1:91764858-91764880 CTGGCTCTGTCTGAGGGAGGGGG - Intronic
911501916 1:98697201-98697223 CAGGCCTAGGATCAGGAAGGTGG + Intronic
912562952 1:110563421-110563443 AAGGCTGAGGCTCATGGAGGAGG + Intergenic
912640674 1:111342627-111342649 CAGGCAGAGGCAAAGGGAGGAGG - Intergenic
912746638 1:112250663-112250685 CAGGCCCAGGCTCAGGAAATGGG - Intergenic
912935410 1:113999811-113999833 CCAACTCAGGCTCAGGCAGGTGG + Intergenic
914447255 1:147760443-147760465 GAGGCTCAGCTTGAGGGAGGAGG - Intronic
914686106 1:149981061-149981083 TTGGCTCTGTCTCAGGGAGGAGG + Intronic
915108046 1:153546532-153546554 AAGGCTCAGGGTCGGGGCGGGGG + Intronic
915618984 1:157067324-157067346 CAGGCCAAGGCACAGGAAGGGGG - Intergenic
915841708 1:159218414-159218436 GTGGCTGAGGCTCAGGGATGTGG + Intergenic
916322163 1:163516916-163516938 AAGGCTAAGGCACAAGGAGGTGG + Intergenic
917901267 1:179545717-179545739 AAGGCTCATGTTCAGGGATGGGG - Intronic
918142527 1:181731611-181731633 CAGGCACAGGCTCAGGGAGGAGG + Intronic
918674644 1:187267913-187267935 CAGCCTAAGGCTCAGGTTGGAGG - Intergenic
919766218 1:201129011-201129033 GAGGCTGAGGCTCAGAGAGGAGG + Intergenic
919839689 1:201599748-201599770 CAGGCTCAGGGACAGGGGGAGGG + Intergenic
919880416 1:201897224-201897246 CAGTCACAGGCCCAGGAAGGCGG - Exonic
919917451 1:202147508-202147530 CAGTCTCAGATTCAAGGAGGAGG + Exonic
920148265 1:203881913-203881935 AAGGCTGAGGCTGAGGCAGGTGG - Intergenic
920387116 1:205576991-205577013 CAGGCTCAGCCACAGGCAGGAGG - Intronic
920435090 1:205942333-205942355 CAGGGCCAGGATGAGGGAGGTGG + Intronic
920549375 1:206845830-206845852 GCATCTCAGGCTCAGGGAGGTGG + Intergenic
920580056 1:207098023-207098045 GAGGCTCAAGGGCAGGGAGGTGG + Intronic
920636997 1:207713593-207713615 CATGCTCAGCCTCTGGGAGGGGG + Intronic
920666047 1:207963659-207963681 CAGGCGCAGGCTCGGGAAGCCGG + Intergenic
921937254 1:220806704-220806726 CAGCCTCATGCTCAGGGGTGAGG - Intronic
922794894 1:228335096-228335118 CGTGCACTGGCTCAGGGAGGAGG + Exonic
923348595 1:233081400-233081422 CAGTCTCAGGCCCAGAAAGGGGG - Intronic
923517439 1:234709539-234709561 CAGGAGCAGGCTCAGGGACTTGG + Intergenic
923770213 1:236931728-236931750 CAGGCACAGGTTGAGGGAAGGGG - Intergenic
924643629 1:245857198-245857220 CATGCTCAGGGTCAGGCTGGTGG + Intronic
1063024179 10:2161814-2161836 CAGGAACAGGGTCAGGGTGGGGG - Intergenic
1063086606 10:2823812-2823834 AAGGCTCAGGCACAAGGAGTGGG - Intergenic
1064105725 10:12499548-12499570 GAGGCTCAGTGTCTGGGAGGTGG + Intronic
1064664679 10:17638561-17638583 TAGGCTGTGGCACAGGGAGGTGG - Intergenic
1065879425 10:30026568-30026590 TGGGCTCAGGCTCAGGGACAGGG + Exonic
1066305472 10:34136268-34136290 CAGGTTCAGGCTTAGGCAGCTGG - Intronic
1066649404 10:37640430-37640452 CAGGCCCTGGCCCAGGGAGGGGG + Intergenic
1066686228 10:37984054-37984076 CAGGCTGTGGCACAAGGAGGGGG + Intergenic
1067032290 10:42885971-42885993 AAGGCCCTGGCCCAGGGAGGGGG + Intergenic
1067058357 10:43065208-43065230 CAAGCCCAGGCCCCGGGAGGGGG + Intergenic
1067462643 10:46469042-46469064 GGGGCAGAGGCTCAGGGAGGTGG - Intergenic
1067532193 10:47082203-47082225 GAAACTAAGGCTCAGGGAGGTGG + Intergenic
1067624552 10:47915595-47915617 GGGGCAGAGGCTCAGGGAGGTGG + Intergenic
1067832955 10:49620893-49620915 CTGGCTGAGGCCCTGGGAGGAGG + Intronic
1068083418 10:52347063-52347085 GAGGGTCAGGCTCAGAGGGGTGG - Intergenic
1069753761 10:70761146-70761168 CAGGCCCAGGGTCTGTGAGGAGG - Exonic
1069837701 10:71319537-71319559 GAGGTCCAGTCTCAGGGAGGAGG - Intronic
1069897318 10:71687717-71687739 CAGGTACAGGCTCAGGTCGGGGG + Intronic
1070309314 10:75261858-75261880 CAGACTGAGGCCCAGAGAGGAGG - Intergenic
1070715800 10:78720119-78720141 CAGACCCAGGCTCAGGGCTGGGG + Intergenic
1070772322 10:79089679-79089701 CTTGCTCATGCTCACGGAGGTGG - Intronic
1070801938 10:79248931-79248953 CAGGCTCTGACCCAGGGAGCAGG - Intronic
1070907070 10:80082326-80082348 CAGGCTCAGTATCAGGCATGGGG - Intronic
1071506516 10:86235073-86235095 CAGGCTCTGGCCCGGGGAGTAGG - Intronic
1072542307 10:96407271-96407293 CAGACACAGGCTCGAGGAGGGGG - Intronic
1072797568 10:98367647-98367669 CAGACTGAGGCTCAGAGAGGAGG - Intergenic
1073300019 10:102465556-102465578 GAGCCTGAGGCTCAGGGAGAGGG + Intronic
1073387986 10:103143537-103143559 GAGGCTGAGGCTGAGGTAGGAGG - Intronic
1073533291 10:104252925-104252947 CAGGCTCAGAATCAAGCAGGTGG - Intronic
1073680144 10:105694345-105694367 CAGCCTCAGGCTTAGGGCTGAGG - Intergenic
1074095466 10:110307940-110307962 CAGTCTCTGCCCCAGGGAGGTGG - Intergenic
1074275087 10:111993410-111993432 CAGACTCAGGCTGAGGGAGCAGG - Intergenic
1074529243 10:114285933-114285955 CAGGCTCAGCTTCAGGGCTGCGG - Exonic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1075576325 10:123580379-123580401 CAGGGAGAGGGTCAGGGAGGTGG - Intergenic
1075742194 10:124702696-124702718 GAGGCTCAAGGACAGGGAGGAGG + Intronic
1076136210 10:128046956-128046978 GGAGCTCAGGCACAGGGAGGCGG - Intronic
1076402085 10:130190963-130190985 CCGGCCCAGGCTTGGGGAGGCGG - Intergenic
1076447297 10:130525348-130525370 AAGGCTCGGGCTCCGGGAGGAGG + Intergenic
1076477908 10:130765465-130765487 CAGGCTGAGGGTCAAGGAAGAGG - Intergenic
1076609326 10:131711331-131711353 GAGGAGGAGGCTCAGGGAGGAGG - Intergenic
1076852554 10:133100164-133100186 CAGGCCCAGGCCCAGGCCGGGGG - Intronic
1076945055 10:133640835-133640857 CCAGCTCGGGCTCGGGGAGGGGG - Intergenic
1076963697 10:133787268-133787290 CAGGGTCAGGGTCAGGGTGAGGG + Intergenic
1077015523 11:397454-397476 CTGGGCCCGGCTCAGGGAGGGGG + Intronic
1077099531 11:815950-815972 ATGGCCCAGGCTCAGGGAAGGGG + Intergenic
1077214988 11:1391458-1391480 CAGGCCCAGGCTCTTGGGGGAGG + Intronic
1077231208 11:1458908-1458930 CAGGCTCAGGCTCAGGCTGCTGG + Intronic
1077256022 11:1583719-1583741 CAGCATCTGGCTCAGGGCGGGGG - Intergenic
1077309601 11:1882496-1882518 GAGACTGAGGCCCAGGGAGGGGG - Intronic
1077579008 11:3404973-3404995 CAGCAGGAGGCTCAGGGAGGAGG + Intergenic
1077599247 11:3562180-3562202 CTGGCTCTGGCTCTGGGAGCTGG - Intergenic
1077811486 11:5642281-5642303 CCTCCTCAGGCTCAGGGAGAAGG + Intronic
1078098237 11:8313414-8313436 CAGGGTCAGGCTCTGGGGGTGGG + Intergenic
1078159794 11:8830761-8830783 CAGGCTCAGCCTCAGAGAATAGG - Intronic
1078438894 11:11347896-11347918 CAGGCTGAGGCTGAGGGCTGGGG + Intronic
1078444338 11:11392994-11393016 CATGCTCAGTCTCCTGGAGGGGG + Intronic
1079076060 11:17386260-17386282 CCCGCTCAGGCACAGGGAGGAGG - Exonic
1079325445 11:19487143-19487165 CAGACCCAGGCTCAGAGAGCAGG - Intronic
1079507529 11:21170041-21170063 TGGGTTCAGGCTCAGGGATGTGG - Intronic
1081747907 11:45485904-45485926 CAGGCCCAGGCTGCTGGAGGTGG - Intergenic
1081753353 11:45527787-45527809 CAGGGTAAAGCTCAGGGAGGTGG - Intergenic
1082025169 11:47566035-47566057 CCGTCCCAGGCTCAGGGCGGTGG - Intronic
1083145897 11:60758195-60758217 CAGACTCAGGGTCAAGCAGGTGG + Intronic
1083169784 11:60916446-60916468 CAGTCTCAGCCTCTGAGAGGAGG - Intronic
1083263884 11:61537340-61537362 CTGTCTCCGTCTCAGGGAGGGGG - Intronic
1083304684 11:61756213-61756235 CTGGCTGAGGCTCAGAGAGAAGG + Intronic
1083479511 11:62934509-62934531 CAGGATCTGGCCTAGGGAGGAGG + Intergenic
1083638503 11:64133014-64133036 CAGGCTGAGGGTCAGTGAGCTGG + Intronic
1083767050 11:64846543-64846565 CAGGATCAGGTTGAGGGAGGAGG + Intergenic
1083769135 11:64856621-64856643 CAGGCTCAGGCTGAGCGGGGTGG - Intronic
1083799020 11:65035614-65035636 CAAGCTCAGCCTCGGTGAGGGGG - Exonic
1083803170 11:65058275-65058297 CAGGGCCAGCATCAGGGAGGGGG + Intronic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084236033 11:67788493-67788515 CAGCAGGAGGCTCAGGGAGGAGG + Intergenic
1084265981 11:68005314-68005336 GAGGCGCAGGGGCAGGGAGGAGG + Intergenic
1084394373 11:68899120-68899142 CCTGCTCAGCCTCAGGTAGGTGG + Intronic
1084760673 11:71268725-71268747 CAAGCCCAGGCTTTGGGAGGAGG + Intergenic
1084817602 11:71658501-71658523 CTGGCTCTGGCTCTGGGAGCTGG + Intergenic
1084836369 11:71804498-71804520 CAGCAGGAGGCTCAGGGAGGAGG - Intergenic
1085252154 11:75151000-75151022 GAGGCTGAGCCTCAGGGAGGCGG + Exonic
1085302088 11:75464680-75464702 CAGGTTTAGGCTTGGGGAGGTGG + Intronic
1085303762 11:75473699-75473721 CCGGCTCAGGTGCAGGGACGGGG - Intronic
1085360310 11:75878887-75878909 CAGGGACAGGGACAGGGAGGGGG + Intronic
1085454908 11:76660243-76660265 CAGGCTCAGGCTGCGGAGGGAGG + Exonic
1085618453 11:78019804-78019826 CAGGGTCTGGCACAGAGAGGTGG - Intronic
1086554657 11:88094684-88094706 CAGGCTCAGGTTAAAGTAGGTGG - Intergenic
1086898710 11:92342069-92342091 CAGACACAGGCTCAAGCAGGTGG - Intergenic
1088086529 11:105987329-105987351 CAGCCTCAGTCTTAGGCAGGCGG - Intergenic
1088770989 11:113036144-113036166 CAGGATCAGGCTCAGGGCTGGGG - Intronic
1089134429 11:116237962-116237984 CAGGACCAGGTTCAGGGTGGAGG + Intergenic
1089275913 11:117336069-117336091 CAGGGTGAGGCTCAGGTTGGGGG + Intronic
1089498313 11:118918840-118918862 CGGGCTCAGGCTCAAGGGTGTGG + Intronic
1089692495 11:120195606-120195628 CAGGAGCAGGGGCAGGGAGGGGG - Intergenic
1089706364 11:120280907-120280929 CACGCACAGGCCCAGGGAGGCGG - Intronic
1089864723 11:121621678-121621700 CAGGCTCAAGTTCAGAGAGCTGG + Intronic
1090077042 11:123586095-123586117 CAGGCGGAGGCTAAGGGAGAAGG - Intronic
1090440075 11:126718194-126718216 CTGCCTCAGGCTCAGGCAGGCGG + Intronic
1090653240 11:128824664-128824686 CAGCCTTGGGCACAGGGAGGTGG + Intergenic
1090746680 11:129710871-129710893 CAAGCCAAGGCTGAGGGAGGGGG + Intergenic
1090804793 11:130196276-130196298 CGTCCTCAGGTTCAGGGAGGAGG + Intronic
1091006076 11:131955157-131955179 GAGGCTGAGGCTGAGGGTGGAGG - Intronic
1091322611 11:134662832-134662854 CAGGCTCAGCCCCTGGGATGTGG - Intergenic
1091617519 12:2060616-2060638 CAGGCTCATGCTTAGAGATGTGG + Intronic
1091760957 12:3086985-3087007 CAGGTTCAGAGTCAGGGAGAGGG + Intronic
1091783226 12:3227070-3227092 CAGGCAGAGGCCCAGGGACGAGG - Intronic
1091978955 12:4850282-4850304 CAGGCTGAGGGTCCGAGAGGGGG + Intronic
1092425390 12:8371528-8371550 CTGGCTCTGGCTCTGGGAGCTGG - Intergenic
1092779216 12:11969865-11969887 CAGGATCAGACTCAGGGCAGTGG + Intergenic
1093707770 12:22294222-22294244 CAGGGTCTTGCTCATGGAGGGGG + Intronic
1095444470 12:42270379-42270401 CAGAGTCAGGCTGAGGGTGGTGG + Intronic
1096214305 12:49791134-49791156 CCGACTCAGGGGCAGGGAGGGGG + Exonic
1096242102 12:49965059-49965081 CTCACTCAGGCTCAGGGAGTTGG - Exonic
1096461086 12:51821709-51821731 CAGGCCCGGGGTCAGGTAGGGGG + Intergenic
1096525571 12:52208104-52208126 CAGGCACTGGCTCAGGGAGCAGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096735661 12:53651833-53651855 GAGGCTGAGGCTGAGGCAGGAGG - Intronic
1096758111 12:53816951-53816973 CAGGCACAGGCTGAGGCAAGAGG - Intergenic
1096846066 12:54407796-54407818 CAGGCTGGGGCCAAGGGAGGGGG - Intronic
1097191260 12:57220661-57220683 CAGGATCAGGCTGTGGGAGGGGG - Intronic
1097312265 12:58133013-58133035 CTGGCTCAGGCCCAGAGAGCTGG - Intergenic
1101299873 12:103468203-103468225 CAGGCTCAAAATCAGGAAGGTGG - Intronic
1101964550 12:109273553-109273575 CAGGCTCATTCTCCGTGAGGCGG + Intergenic
1102164458 12:110795336-110795358 CAGGCTCAGAGTCAGAGATGGGG + Intergenic
1102950086 12:117025649-117025671 CAGGCACAGCCACAGCGAGGGGG - Intronic
1103419225 12:120766740-120766762 CAAGCTGAGGCTCAGAGAGGTGG - Intronic
1103434241 12:120912529-120912551 GAGGCTGAGGCTGAGGAAGGTGG - Intergenic
1103459642 12:121093649-121093671 GAGACTCAGGCTCAGGCATGGGG + Intergenic
1103946019 12:124526869-124526891 GAAACTGAGGCTCAGGGAGGTGG - Intronic
1104017801 12:124972026-124972048 CAGCCTCAGGCTGAGGGAAAGGG - Intronic
1104318115 12:127723073-127723095 CATGCTCAGGATCAAGTAGGGGG + Intergenic
1104685325 12:130781015-130781037 CAGGTTGTGGCTCAGGGAGGCGG + Intergenic
1104756826 12:131274454-131274476 CCAGCTCAGTCCCAGGGAGGAGG - Intergenic
1104789346 12:131472152-131472174 CCGGCTCATCCTCAGGGAGATGG + Intergenic
1105302746 13:19150692-19150714 CAGGCCCAGGTTCATGGAGAAGG - Intergenic
1105407403 13:20143581-20143603 TAGGGTCAGCCTCAGGGAGAGGG - Intronic
1105699927 13:22927843-22927865 CAGGCTCAGGCTGGGAGAGAGGG + Intergenic
1105852734 13:24350027-24350049 CAGGCTCAGGCTAGGAGAGAGGG + Intergenic
1106035942 13:26045793-26045815 AAGGCTCAGGCTGGGGGCGGTGG + Exonic
1106114294 13:26803698-26803720 CAGGCTGAAGCTCAGGGACAGGG + Intergenic
1106907695 13:34425771-34425793 CATGCTCAAGCACAGGGAGTCGG + Intergenic
1108080910 13:46734632-46734654 CAGCCTCAGCCTCAGGCAGATGG + Intronic
1108504672 13:51101775-51101797 AAGGCTCAGACGCAGGGAGGAGG + Intergenic
1108945393 13:56016975-56016997 CAGGGTGAGGCTGAGAGAGGAGG - Intergenic
1108954244 13:56132501-56132523 GAGGCAGAGGCTGAGGGAGGGGG + Intergenic
1113299288 13:108999003-108999025 CATGCCCAGGTTCAGAGAGGTGG + Intronic
1113400270 13:109985983-109986005 CAGGGTCAGGCAGTGGGAGGAGG - Intergenic
1113671815 13:112180815-112180837 GTGGCTCAGGCAGAGGGAGGAGG + Intergenic
1113935849 13:113995338-113995360 GAGGCTGAAGCTCAGGAAGGGGG - Intronic
1114497567 14:23143577-23143599 CAAAATCAGGCTCAGGAAGGTGG - Intronic
1115346130 14:32344985-32345007 TAGGATGAGGCTCAGAGAGGAGG + Intronic
1115429440 14:33299464-33299486 CAAGCTCAGGCTCTATGAGGTGG - Intronic
1115474197 14:33798612-33798634 CAGACCCAGCTTCAGGGAGGCGG + Intronic
1115657584 14:35458921-35458943 GAGGCTCAGGCCCAGGGAGAAGG - Intergenic
1115746588 14:36443962-36443984 CGGGCTCAGGCTTAGGAAGGAGG - Intergenic
1116177441 14:41490422-41490444 CAAGCTCAGTGTCAGTGAGGTGG - Intergenic
1116207581 14:41887780-41887802 CAGGATCAGGCTCATGGATATGG - Exonic
1116837526 14:49785642-49785664 AAGGCTCAGGCTGAGGCGGGTGG + Exonic
1117880858 14:60312194-60312216 GAGGCTGAGGCTGAGGCAGGGGG - Intergenic
1117930800 14:60838822-60838844 CTGGAACAGGCTCAGGGAGCAGG - Intronic
1118319618 14:64745545-64745567 CAGTGTGAGGGTCAGGGAGGCGG - Exonic
1118708580 14:68501807-68501829 CAGGTTCAGGCACAGGCATGGGG + Intronic
1118837237 14:69485602-69485624 AAGGCTCAGGCTAAGGAGGGAGG + Intronic
1119428098 14:74549117-74549139 CAGGCCCAGGCCCAGAAAGGAGG + Intronic
1119640820 14:76313566-76313588 CAGGCTCAGGTGCAGGAAGAGGG + Intronic
1119661736 14:76457034-76457056 CTGCCACAGGCTCAGGAAGGGGG - Intronic
1119732031 14:76957127-76957149 GAGGCTGGGGCTGAGGGAGGGGG - Intergenic
1120064182 14:80020342-80020364 CAGGCTCAGGATTAGGGATTGGG - Intergenic
1120222851 14:81754665-81754687 CAGGCTGTAGCTCAGGGAAGGGG + Intergenic
1120999288 14:90440015-90440037 CTGGCTCAGGCTGAGGAGGGAGG - Intergenic
1121559118 14:94861444-94861466 AATGCTCAGGCTAGGGGAGGTGG + Intergenic
1121740588 14:96249371-96249393 CAGACTGAGGCTCTGGAAGGTGG + Intronic
1122078182 14:99248845-99248867 CAGGCTCAGCCCCAGAGACGGGG + Intronic
1122097491 14:99382172-99382194 CAGGCCCCGTGTCAGGGAGGAGG - Intergenic
1122371564 14:101231825-101231847 CATGCAGAGGCTCATGGAGGAGG - Intergenic
1122686406 14:103509901-103509923 AAAGCTCTGGCCCAGGGAGGTGG - Intergenic
1122776761 14:104120421-104120443 GAGGCCCAGGCTCAGTGAGTAGG + Intergenic
1122827833 14:104379816-104379838 CAAACTCAGGTTCAGGGAAGTGG + Intergenic
1122960531 14:105091931-105091953 CAGGCCCAGGCCCTGGGAGCTGG - Intergenic
1123017971 14:105384557-105384579 CAGGCTCAGCCTCAGGGAAGAGG + Intronic
1202899801 14_GL000194v1_random:28421-28443 CCGGCGCAGGCGCAGGGGGGTGG - Intergenic
1202918406 14_KI270723v1_random:6153-6175 CCAGCTCGGGCTCAGGGAGGGGG - Intergenic
1125028232 15:35051883-35051905 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
1125200220 15:37096135-37096157 CAGGCTCAGGGATGGGGAGGAGG + Intronic
1125728681 15:41881111-41881133 CAGGGTCAGGCTCAGCTGGGAGG + Exonic
1125769405 15:42154836-42154858 CACTCCCAGGCACAGGGAGGAGG + Intronic
1125893422 15:43282474-43282496 CAGGCTCTGGCTCTGTGGGGAGG - Intronic
1126105044 15:45141905-45141927 CTGGCACAGGATCACGGAGGAGG - Intronic
1126894115 15:53239805-53239827 CAGGCTCCTGATCAGTGAGGTGG + Intergenic
1127142630 15:55993382-55993404 CAGGCTCGCGCCGAGGGAGGAGG + Intronic
1128341822 15:66827645-66827667 TAGGCTCAGGGTCAGGGAGAGGG - Intergenic
1128548836 15:68584774-68584796 CAGGCTCAGGCCCAGGGTCCTGG + Intronic
1128612385 15:69084484-69084506 CAAGCTGAGTCCCAGGGAGGGGG + Intergenic
1129326457 15:74802580-74802602 CAGGCTCGGGCCCAGTGAGCAGG - Exonic
1129355830 15:74990874-74990896 CATGCTAAGTGTCAGGGAGGTGG + Intronic
1129771560 15:78206365-78206387 CAGGGACAGGCTGAGGAAGGAGG - Intronic
1130657063 15:85799131-85799153 CAGGGTCAGGAACAGGGAGGTGG - Intergenic
1131045070 15:89307927-89307949 CATGCTCAGGCTCAAGGACTTGG + Intronic
1132206260 15:99988043-99988065 CAGGCTCAGGCTCTGGCTGGGGG + Intronic
1132390295 15:101433751-101433773 GAGGCCAAGGCTCAGGGAGGAGG - Intronic
1132402383 15:101520736-101520758 AAGGCACGGGCACAGGGAGGTGG - Intronic
1132455499 16:19753-19775 CAGGGTCAGGGTCAGGGTGAGGG - Intergenic
1132574452 16:658103-658125 CAGGGTCAGGCTCGGGAGGGAGG - Intronic
1132575423 16:661661-661683 CATGCACCGGCTCCGGGAGGCGG - Exonic
1132618627 16:854247-854269 CAGGCTGGGCCTCTGGGAGGAGG + Exonic
1132804615 16:1769710-1769732 CAGGCTCAGCCTCAGGTTGATGG + Exonic
1132866498 16:2095475-2095497 CAGGGTCTGACTCAGGGAGCAGG + Intronic
1133164801 16:3938983-3939005 CTGGCTCAGGAACAGGGATGGGG - Intergenic
1133234673 16:4382295-4382317 CAGCCCCACGCGCAGGGAGGTGG - Exonic
1133247045 16:4455795-4455817 CTGGCTCAGGCAGAGGGAGATGG + Exonic
1133347611 16:5081066-5081088 CAGCAGGAGGCTCAGGGAGGAGG + Intronic
1133372957 16:5259381-5259403 CTGGCTCTGGCTCTGGGAGCTGG + Intergenic
1134837587 16:17375069-17375091 CAGACACAGGCTCAGAGAGGTGG + Intronic
1134849746 16:17470495-17470517 CAGGCGCGGGCGCGGGGAGGCGG - Exonic
1135060643 16:19268675-19268697 GAGGCTGAGGCTGAGGCAGGTGG - Intergenic
1135616193 16:23913111-23913133 GAGGCTGAGGTTCAAGGAGGTGG + Intronic
1135620279 16:23949927-23949949 CAGCCTGAGGCACAGGGAAGAGG - Intronic
1135852663 16:25978805-25978827 AAGGCTCAGGCAAAGTGAGGAGG + Intronic
1136058772 16:27710243-27710265 CTGGCTCAGCCTCAAGTAGGTGG - Intronic
1136516288 16:30770442-30770464 GAAACTGAGGCTCAGGGAGGTGG + Intronic
1137018284 16:35397189-35397211 CAGGATGAGGGGCAGGGAGGAGG - Intergenic
1137054059 16:35735064-35735086 CCGGCACAGGCACAGGCAGGCGG - Intergenic
1137701369 16:50500350-50500372 CAGTCTCTGGCTTAAGGAGGGGG + Intergenic
1138197616 16:55063308-55063330 CAGGCTGTGGCACAGGGAGAGGG + Intergenic
1138250827 16:55500616-55500638 CTGGCTCTGGCTTTGGGAGGTGG - Intronic
1138343932 16:56308586-56308608 CAGGATCTGGCTCAGGGAGAAGG + Intronic
1138468559 16:57212623-57212645 AAGGCTCCGTCTCAGGGGGGTGG - Intronic
1138529930 16:57629488-57629510 AGGGGCCAGGCTCAGGGAGGGGG + Intronic
1139424054 16:66868053-66868075 CAGGCTCAGGCCCCGGGTGGTGG - Intronic
1139448624 16:67013899-67013921 CAGGCTCAGCCCCAGGTGGGCGG - Intergenic
1140376160 16:74446938-74446960 CAGCAGAAGGCTCAGGGAGGAGG + Intergenic
1140935140 16:79663354-79663376 CACGCTGAGGCTCAGAAAGGGGG + Intergenic
1141179253 16:81741136-81741158 CTGGCCCACTCTCAGGGAGGTGG + Intronic
1141527201 16:84618753-84618775 CAGCCTCAGGGGCAGGGGGGTGG - Intergenic
1141595080 16:85092449-85092471 CAGCCCCAGCCTCAGGGACGGGG + Exonic
1141611523 16:85183762-85183784 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1141707569 16:85676293-85676315 CTGGCTCAGGCTCTAAGAGGAGG + Exonic
1142024247 16:87804078-87804100 AATGCTCAGGCGAAGGGAGGTGG + Intergenic
1142338927 16:89508264-89508286 CGGGCTCAGGCTCGGGGGTGCGG + Intronic
1142488210 17:260350-260372 CAGCCTCCTGCTCAGGAAGGTGG - Intronic
1142583460 17:955989-956011 GAAACTGAGGCTCAGGGAGGAGG - Intronic
1142643938 17:1300228-1300250 CAGGCTCTGGCTCTGGAAGGAGG + Exonic
1142756995 17:2022512-2022534 GAGGCTAATGCCCAGGGAGGTGG - Intronic
1143078495 17:4365485-4365507 CAGGCTCTGGCCCGGGGCGGCGG - Intronic
1143299411 17:5898601-5898623 CCGGCGCAGGGTAAGGGAGGGGG + Intronic
1143352008 17:6295698-6295720 CAGGCTGGGGCTGAGGGAAGAGG - Intergenic
1143382037 17:6502602-6502624 CAGGCCTGAGCTCAGGGAGGTGG + Intronic
1143406201 17:6678560-6678582 GAGGGTCAGGCTCTGGGAAGGGG - Intergenic
1143454698 17:7058969-7058991 CAGGCTGATTCTCAGGCAGGAGG + Intergenic
1143611343 17:8019618-8019640 GAGGCTGAGGCACAGAGAGGAGG - Intronic
1143679790 17:8467712-8467734 CAGACTCGGGGTGAGGGAGGCGG + Exonic
1143684799 17:8505018-8505040 CAGCCTCAGGCCCCAGGAGGAGG - Intronic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1144675439 17:17158669-17158691 CAGGCTCCGCCTCAGGGCGCAGG - Exonic
1144871977 17:18377448-18377470 CAGGCGCAGGCTCAGCGGAGAGG - Intergenic
1145159966 17:20567657-20567679 CTGGCTCTGGGTCTGGGAGGTGG + Intergenic
1146892452 17:36514807-36514829 CAGCCTCAAGCTCAGGGATATGG + Intronic
1147176153 17:38657454-38657476 CTGGCTGGGGCTCCGGGAGGTGG - Intergenic
1147183565 17:38702067-38702089 CAGACCCAGGCTCGGGGAAGAGG - Intergenic
1147236389 17:39060814-39060836 GAAACTGAGGCTCAGGGAGGTGG - Intergenic
1147361601 17:39934165-39934187 CAGGCACAGGCTGGGGGATGGGG - Intergenic
1147599787 17:41738677-41738699 CAGGGTCAGGCCAGGGGAGGGGG - Intergenic
1147790832 17:43013526-43013548 CAGCCTCAGGCTGAGTGAGGAGG + Exonic
1147960733 17:44166114-44166136 CAGGCTGAGGCTAAGGCAGGAGG - Intergenic
1148022071 17:44559863-44559885 CAGGCCCAGCGTCAGAGAGGAGG - Intergenic
1148203434 17:45765039-45765061 CCAGCTCAGGGTCAGGGAGCTGG - Intergenic
1148450870 17:47777217-47777239 CATGGTCAGGCTCAGGTAGCTGG - Intergenic
1148647947 17:49230089-49230111 CAGGGGCAGGGGCAGGGAGGTGG + Intronic
1148810694 17:50289062-50289084 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
1148957305 17:51364482-51364504 CTGTCTCAGGCTAAGGGAGGTGG + Intergenic
1149449373 17:56737961-56737983 CAGGCGCTGGCTGTGGGAGGTGG - Intergenic
1150239903 17:63622813-63622835 CCGCCCCAGGCTGAGGGAGGAGG + Intronic
1150643761 17:66965679-66965701 CAGGCTCGGGCTGAGGGGTGGGG + Intronic
1151210486 17:72540545-72540567 GCGGCTCAGGCCCAGGGAAGAGG + Intergenic
1151493222 17:74444682-74444704 CAGGTTCAGGCTCAGGGAGAGGG - Intronic
1151568905 17:74916289-74916311 CAGGCTCAGGCCCAGAGAACAGG + Exonic
1151660131 17:75514593-75514615 GAGGGTCAGGCACAGGCAGGCGG + Intronic
1151767153 17:76138485-76138507 CAGGCCCAGGCAAAGGGAGACGG - Intronic
1151995512 17:77606307-77606329 CAGGAGCAGGCCCTGGGAGGAGG + Intergenic
1152077371 17:78168138-78168160 CAGGCTTAGCCCCAGAGAGGAGG + Intergenic
1152198322 17:78930368-78930390 CAGTCTCAGGGGCAGGGAGCCGG + Intergenic
1152201813 17:78951810-78951832 CAGGGTCAAGCTCATGGAGCCGG + Intergenic
1152630676 17:81409468-81409490 CAGGAGCGGGCTCAGGGTGGGGG + Intronic
1152634000 17:81423080-81423102 CAGGCCCAGGCCCAGGGCAGGGG - Intronic
1154155346 18:11940018-11940040 GAGGCTGAGGCTGAGGCAGGTGG + Intergenic
1155085812 18:22456824-22456846 CAGACTCAAGCTCAGGGAAATGG + Intergenic
1155344093 18:24841580-24841602 CAGGCCCATGCACAGGGAGAAGG - Intergenic
1155570148 18:27184586-27184608 CAGGCTCAGGCGCAGGCTGCGGG - Intronic
1156390858 18:36649301-36649323 CTGGCTTTGTCTCAGGGAGGAGG + Exonic
1156548912 18:37994382-37994404 CAGGTGCAATCTCAGGGAGGTGG + Intergenic
1157717059 18:49895033-49895055 CAGCCTCAGGCTGCAGGAGGAGG - Exonic
1157804848 18:50650382-50650404 CAGGCCCAGGCTAGGGGAGCAGG - Intronic
1158415395 18:57245929-57245951 TGGGCTCAGAATCAGGGAGGTGG + Intergenic
1158892818 18:61889018-61889040 CAGGCACAGACTGAGGGAGAAGG - Intronic
1159615835 18:70578633-70578655 CAGGCCTGGGGTCAGGGAGGTGG - Intergenic
1160340592 18:78085674-78085696 CAGGGTCAGGCTCATGCACGCGG + Intergenic
1160447132 18:78936661-78936683 AAGGCTGAGGGCCAGGGAGGTGG + Intergenic
1160447151 18:78936707-78936729 AAGGCTGAGGGCCAGGGAGGTGG + Intergenic
1160518321 18:79490372-79490394 CAGGCTCTGGGTCAGGATGGGGG + Intronic
1160555758 18:79723882-79723904 CAGGAACTGGCTGAGGGAGGAGG - Intronic
1160749551 19:727471-727493 CAGGGTCAGGATCAGGGTCGGGG - Intronic
1160855363 19:1214854-1214876 CCGGCTCCTGCTGAGGGAGGGGG + Intronic
1161173019 19:2822758-2822780 CAGCCACAGGCTGAGGTAGGAGG + Intronic
1161262767 19:3346723-3346745 CAGGCACAGGGGCACGGAGGGGG - Intergenic
1161288153 19:3479241-3479263 CAGGCAGAGGCTCAGGGGGAGGG + Intronic
1161352806 19:3803348-3803370 CAGGCCCAGGCCAAAGGAGGGGG - Intergenic
1161473861 19:4473885-4473907 CAGGCCCGGGCCCAGGGAGTGGG + Intronic
1161554782 19:4934828-4934850 AAGGCCCAGACTCAGTGAGGAGG - Intronic
1161684803 19:5697486-5697508 GAGGCTGAGGCAGAGGGAGGAGG + Intronic
1161828544 19:6586176-6586198 CAGGCTGATGCTACGGGAGGCGG + Exonic
1161942612 19:7415197-7415219 CAGGAGCAGGGTTAGGGAGGTGG - Intronic
1162513159 19:11131953-11131975 CAGGCTCTGCCTCTGGGAAGTGG - Exonic
1162575845 19:11498266-11498288 GAGGCTCAGCCTGGGGGAGGTGG - Intronic
1162773603 19:12965458-12965480 CAGGCTTGGCCTCTGGGAGGCGG + Intronic
1162834112 19:13305010-13305032 CAGGGTCTGCCTCAGGCAGGGGG - Intronic
1163121917 19:15223421-15223443 TTGGCTCAGGCTGGGGGAGGCGG + Intergenic
1163129917 19:15265908-15265930 GAGGCCCAGGCTCAAGGAGCAGG + Intronic
1163160961 19:15463998-15464020 CCGGCCCAAGCTCAGGGTGGGGG + Intronic
1163322886 19:16585019-16585041 CAGGCTCACGTGGAGGGAGGTGG - Intronic
1163495889 19:17646497-17646519 GAGGCTGAGGCTGAGGCAGGCGG - Intronic
1163555124 19:17987672-17987694 CCTGCTCAGGCTCAGGGTGTTGG + Intronic
1163578874 19:18126317-18126339 CAGGGGGAGGCTCTGGGAGGAGG + Intronic
1163688506 19:18725659-18725681 GAGGCTCAGGAAGAGGGAGGAGG - Intronic
1163728951 19:18938938-18938960 CAGGGCCAGGCTGGGGGAGGTGG + Intronic
1163769257 19:19180723-19180745 CAGGATCAGGCTGAGGAGGGCGG + Exonic
1163775026 19:19212651-19212673 CACGTTCTGACTCAGGGAGGAGG + Intronic
1163861957 19:19747447-19747469 CAGGCAGAGGCTCTGGGACGGGG + Intergenic
1164300347 19:23956590-23956612 CAGGCTTAGGCTCAGGTGGATGG - Intergenic
1164590610 19:29504918-29504940 GGGACTCAAGCTCAGGGAGGGGG + Intergenic
1164593176 19:29517283-29517305 CAGCCTCAGACTCTGGGAGCTGG + Intergenic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1165166933 19:33863528-33863550 AAGTCTCAGCCTCATGGAGGTGG + Intergenic
1165199809 19:34134531-34134553 CGGGCGCAGGCGCAGTGAGGTGG - Intergenic
1165279345 19:34783262-34783284 AAGGATCAGGGTCAGAGAGGAGG + Intergenic
1165282312 19:34807775-34807797 CATTCTCAGGCTCTGGGATGGGG + Intergenic
1165315796 19:35054703-35054725 GAAGCTGAGGCTCAGAGAGGTGG - Intronic
1165346836 19:35253871-35253893 CAGGCTCTGTCTCGGGGAAGGGG + Intronic
1165699502 19:37926590-37926612 GTGGCTCAGGCTTGGGGAGGGGG + Intronic
1165700257 19:37932175-37932197 CAGGCGCAAGCTCAGGGCAGGGG + Intronic
1166051522 19:40263590-40263612 CAGGCTCAGGCTGGGGGACTGGG + Intronic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166267780 19:41695768-41695790 CAGGCTCAGGATCTGAGGGGTGG - Intronic
1166373466 19:42314703-42314725 CAGGCTCAGCCTGGGGGAGTGGG + Intronic
1166380390 19:42352493-42352515 CAGGCTGGGGCACATGGAGGTGG + Intronic
1166672930 19:44722411-44722433 CAGGGACAGGCTGAGGGAAGAGG - Intergenic
1166678887 19:44755672-44755694 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
1166679002 19:44756343-44756365 GAGGCTCGGTCTGAGGGAGGAGG + Intronic
1166711535 19:44940820-44940842 CAGGCCCAGGGCCAGGGCGGTGG - Intergenic
1166883030 19:45940442-45940464 GAGGCCCAGGCCCAGGGAGTTGG + Exonic
1167148688 19:47696730-47696752 CAGGCTGGGGCTCAGGAGGGCGG + Intronic
1167271628 19:48509485-48509507 CCGGCTAAGGCCCAGGGGGGTGG + Exonic
1167399004 19:49252500-49252522 CATGCCCAGGCTCAGGGAAGAGG + Intergenic
1167486068 19:49763571-49763593 CACGCTTAGTCTCAGGGAGAGGG - Intergenic
1167674762 19:50877399-50877421 CGGGCTCTGGGGCAGGGAGGAGG + Intronic
1167768325 19:51499038-51499060 AAGGCTGAGGCTGAGGGAGGGGG + Intronic
1168080012 19:54003188-54003210 CAGGCTCAGGGAGGGGGAGGCGG + Intronic
1168728659 19:58606944-58606966 CCGGCGCAGGCGCAGAGAGGGGG - Intergenic
1168728667 19:58606974-58606996 CCGGCGCAGGCGCAGAGAGGGGG - Intergenic
1168728675 19:58607004-58607026 CCGGCGCAGGCGCAGAGAGGGGG - Intergenic
1168728690 19:58607064-58607086 CCGGCGCAGGCGCAGAGAGGGGG - Intergenic
1168728701 19:58607098-58607120 CCGGCGCAGGCGCAGAGAGGGGG - Intergenic
1168728709 19:58607129-58607151 CCGGCGCAGGCGCAGAGAGGGGG - Intergenic
1168728724 19:58607167-58607189 CCGGCGCAGGCGCAGAGAGGGGG - Intergenic
1168728732 19:58607198-58607220 CCGGCGCAGGCGCAGAGAGGGGG - Intergenic
925047331 2:782680-782702 CATGCTCTGGCCCAGGGAGGTGG + Intergenic
925309868 2:2874948-2874970 CTGGCTCTGGCTCTGGGCGGAGG - Intergenic
925376330 2:3388507-3388529 CTCGCTCATGCTCAGGGCGGTGG - Exonic
926126922 2:10277647-10277669 CAGGCAGAGGCAGAGGGAGGAGG + Intergenic
927149764 2:20188860-20188882 CAGGGCCAGGCGCAGGGAGCTGG + Intergenic
927461442 2:23301905-23301927 CAGGGTCAAGGTCAGGGGGGTGG + Intergenic
927487064 2:23495740-23495762 CAGGCTCCGGCTCATGGCTGTGG + Intronic
927491665 2:23525270-23525292 CAGGCTCAGGGACAGGCAGTGGG - Intronic
927639542 2:24838068-24838090 CAGGGAGAGGCTCAGAGAGGAGG - Intronic
927854673 2:26520527-26520549 CAGTTTCATCCTCAGGGAGGTGG - Intronic
928276418 2:29904838-29904860 CAGGAACAGGCTCAGAAAGGTGG - Intronic
928469869 2:31563519-31563541 CAGGCTGAGGTACAGGGAAGGGG + Intronic
929432052 2:41895486-41895508 CAGGCTCAGGCACAGAGACAGGG - Intergenic
930221180 2:48748326-48748348 CAGTCTGAGGCTTAGGGATGGGG + Intronic
930730393 2:54723497-54723519 CAGGGACAGGCAGAGGGAGGGGG + Intronic
930907762 2:56593498-56593520 AAGGCTCAGGCTGATGGTGGGGG + Intergenic
931450627 2:62364962-62364984 CAGGCTGAGGCTGAAGCAGGAGG - Intergenic
932199297 2:69811590-69811612 GAGTCTCAAGCTCAGGAAGGAGG - Intronic
932220680 2:69996740-69996762 CAGACTCAGCCTCAGGTAGATGG - Intergenic
932334606 2:70922820-70922842 CAGGCTTGTGCTCAGAGAGGAGG + Intronic
932688261 2:73891721-73891743 CTGGATCAGGGTGAGGGAGGGGG + Intergenic
933950195 2:87322658-87322680 CCAGCTCAGGCTCAGGGAGACGG + Intergenic
934652004 2:96098170-96098192 AAGGCCCAGGCCCAGAGAGGAGG + Intergenic
934662955 2:96152887-96152909 CAGGCCCCGTCTCAGGGAGGAGG - Intergenic
934761152 2:96857832-96857854 CAGGCCCCGGCCCAAGGAGGAGG - Intronic
935591881 2:104852519-104852541 CAGGCTCTGGCTGGGGGCGGCGG + Intergenic
935627573 2:105184099-105184121 CGGGCCCAGGCTGAGGGAAGTGG - Intergenic
936161361 2:110086273-110086295 AGGGGTCAGGCTCAGGGAGTGGG - Intronic
936183302 2:110285081-110285103 AGGGGTCAGGCTCAGGGAGTGGG + Intergenic
936270781 2:111046928-111046950 CAGGGCCAGGCTCAGAGTGGTGG + Intronic
936329992 2:111538939-111538961 CCAGCTCAGGCTCAGGGAGACGG - Intergenic
936467644 2:112767389-112767411 TGGGCTAAGGCTAAGGGAGGTGG - Intergenic
937254567 2:120546129-120546151 CAGGCTCGGGAGCAGTGAGGTGG + Intergenic
937648807 2:124297322-124297344 GAGAGACAGGCTCAGGGAGGGGG - Intronic
937693411 2:124781234-124781256 GAGGTACAGGCTCAGGGAAGAGG + Intronic
937791024 2:125961833-125961855 CAGGCTCAGCCACAGGGTGAAGG + Intergenic
938059015 2:128237915-128237937 GAGGCTGAGGCTGAGGCAGGTGG - Intronic
938548944 2:132361715-132361737 CAGCCTCAGGCGCAGGAGGGAGG - Intergenic
938810073 2:134844690-134844712 CAGGCGCTGGCTGATGGAGGTGG + Intronic
940367377 2:152863206-152863228 CAGCCTCAGCCTCAGGTAGTTGG - Intergenic
940887699 2:159003872-159003894 CAGGCTCAGGTCCAGATAGGGGG + Intronic
941029246 2:160493211-160493233 CAGGGTCAGGCCTGGGGAGGGGG - Intronic
942525171 2:176845420-176845442 TTGGCCCAGGTTCAGGGAGGTGG + Intergenic
944766734 2:202871764-202871786 CAGGCTCCCGCTGCGGGAGGCGG + Intronic
946225384 2:218261613-218261635 GAGGCCCAGGCTCAGGGTGCTGG + Intronic
946325852 2:218984441-218984463 CTGGACCAGGCTCCGGGAGGAGG - Intronic
946327658 2:218993119-218993141 CAGCCTCACGCTCTGGGACGAGG - Exonic
946336508 2:219040861-219040883 GAGGCTGAGGCTCCGGGAGATGG - Intronic
946403583 2:219481390-219481412 CCTGCTCAGGCTCAGGAATGTGG - Exonic
946884655 2:224210861-224210883 CAGGCCCAGGCCCAAGGTGGTGG + Intergenic
947152286 2:227128198-227128220 TAGGCTCAGGCTCAGGTAGGGGG - Intronic
947533689 2:230928045-230928067 CAGGTGCAGGCACAGGCAGGAGG + Intronic
947670503 2:231932730-231932752 CCGGCTCTGGCTGAGGGAAGTGG - Intergenic
947732449 2:232438958-232438980 GAGGCACAGACCCAGGGAGGAGG + Intergenic
948214758 2:236220404-236220426 CAGGCTCTGGCTGAGAGAAGAGG - Intronic
948260408 2:236600316-236600338 CAGGCCCGGGCTCAGACAGGGGG - Intergenic
948301929 2:236914076-236914098 CAGGCACAGGCTCACCCAGGTGG + Intergenic
948459581 2:238122684-238122706 CAGGTTCCATCTCAGGGAGGGGG + Intronic
948624611 2:239261438-239261460 CAGGCCTGGGCTCTGGGAGGTGG + Intronic
948865967 2:240775022-240775044 CAGGTTCAGTCCCAGGGCGGGGG - Intronic
948886303 2:240886854-240886876 CAGGCCCTGACCCAGGGAGGAGG + Exonic
1168767468 20:391451-391473 CAGCCTCAGGCTCAGGGATACGG - Exonic
1168891404 20:1297263-1297285 CAGGGCCAGGCCCAGAGAGGAGG - Intronic
1168936888 20:1673353-1673375 TAGGATGAGGCTCAGAGAGGAGG + Intergenic
1169068879 20:2709640-2709662 CAGGTACAGGCTCAGGGAGGGGG + Exonic
1169280467 20:4262818-4262840 CAGGCTGAGGGTCAGGGTGCAGG + Intergenic
1169754450 20:9028647-9028669 CGGGCTCAGGCACAGAAAGGGGG - Intergenic
1170573494 20:17646112-17646134 CAGGCCTGGGCTCAGGGGGGTGG + Intronic
1172014471 20:31864744-31864766 GAGACTGAGGCTCGGGGAGGTGG + Intronic
1172049977 20:32109910-32109932 CAGGGGCAGGGCCAGGGAGGTGG - Intronic
1172119867 20:32591975-32591997 CTGGGTCAGTCTCAGGGAGCAGG + Intronic
1172167819 20:32909613-32909635 AAGGCTCAGTCTCGGGGAGCGGG + Intronic
1172446225 20:34994837-34994859 CAGGCTCAGGCTAGTGCAGGAGG + Intronic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172768244 20:37362578-37362600 GAGGCTAAGGCTCAGAGAAGGGG - Intronic
1172773697 20:37395624-37395646 CAGGCCCAGGCTCAGGCGGGAGG - Intronic
1173185394 20:40836449-40836471 GAAACTCAGGCTCAGAGAGGTGG + Intergenic
1173952118 20:47001626-47001648 AGGGCTCAGGCCCAGGGAGGTGG - Intronic
1174159687 20:48541990-48542012 CAGGCTCAGGCTCGCAGTGGAGG + Intergenic
1174304884 20:49608137-49608159 CAAGCTGAGGCTCGGAGAGGTGG - Intergenic
1174406629 20:50307038-50307060 CAGGCTCAGGAGCTGGGAGTGGG + Intergenic
1174577356 20:51545984-51546006 CAGGGTAAGCCTCAGGGTGGAGG - Intronic
1174735709 20:52963955-52963977 CAGGGAAAGGCTCTGGGAGGAGG - Intergenic
1175248420 20:57595085-57595107 CAGCTTCAGACACAGGGAGGCGG - Intergenic
1175751494 20:61501171-61501193 TAGACTCAGGCTGGGGGAGGTGG + Intronic
1175940585 20:62535876-62535898 GAGGCCCAGGCCCAGGGCGGAGG + Intergenic
1175986457 20:62766280-62766302 CAGGCTCAGGGGCAGGGCTGGGG + Intergenic
1176008125 20:62877182-62877204 CAGGGACAGGCTCGGGGAGCTGG - Intergenic
1176364907 21:6026883-6026905 CTGGCTCAGGCGAAAGGAGGAGG - Intergenic
1176619175 21:9043195-9043217 CCGGCGCAGGCGCAGGGGGGTGG - Intergenic
1176921687 21:14695203-14695225 GAAGCTCAGGCTCAAGGAGTGGG - Intergenic
1178383245 21:32129134-32129156 TTGGCTGAGGGTCAGGGAGGTGG - Intergenic
1178476970 21:32945358-32945380 CAGGCTCTGGCTCTGGGGGGAGG + Intergenic
1178858458 21:36269764-36269786 GAGGCTGAGGCTGAGGCAGGGGG - Intronic
1178883195 21:36464692-36464714 CATGCTCAGGCTCAGTCAGCTGG - Intronic
1178896336 21:36561714-36561736 CTGGCTGAGACTCAGGGAGAGGG - Intronic
1179758611 21:43511662-43511684 CTGGCTCAGGCGAAAGGAGGAGG + Intergenic
1180142365 21:45900221-45900243 CTGGCTCAGCCTCCCGGAGGTGG - Intronic
1180184854 21:46134449-46134471 CAGGGTCAGGGTCAGGGTGAGGG + Intergenic
1180967270 22:19797216-19797238 GAGCCCCAGGCTCAGGGAGCTGG - Intronic
1181434491 22:22902448-22902470 CAGGCTCAGGGTCAGGCTCGAGG + Intergenic
1181813545 22:25420546-25420568 GATGTTCAGGCTCAGGAAGGAGG + Intergenic
1182037996 22:27214366-27214388 CAGACTCAAGTTCAGGGAGGGGG - Intergenic
1182183522 22:28376653-28376675 CAGGCTCCAGCTCTGGGAAGGGG + Intronic
1182437616 22:30340855-30340877 CAGGCTCAGCTACAGGGAGGTGG - Intronic
1182484284 22:30630063-30630085 CAGGCCCAGTCTCAGGGGGCAGG - Intergenic
1182930179 22:34166103-34166125 CATTCTCAAGCTCATGGAGGAGG + Intergenic
1183345770 22:37306951-37306973 CAGCCCCAGGCTCCAGGAGGGGG - Intronic
1183678041 22:39310753-39310775 CAGGCCCAGCCTAAGGGATGGGG + Intergenic
1184296395 22:43527939-43527961 TAGGCTTGGGCTCAGGAAGGCGG + Intergenic
1184430165 22:44437878-44437900 AGGGCAGAGGCTCAGGGAGGTGG + Intergenic
1184455405 22:44607203-44607225 CAGGCAGGGGCCCAGGGAGGAGG + Intergenic
1184600843 22:45542484-45542506 CAGGCTCACACACAGGGGGGTGG - Intronic
1184746980 22:46461844-46461866 CAGGCACTGGCTCGGGGAAGGGG + Intronic
1184984232 22:48118541-48118563 CAGGGTCAGGCCCAGGGGAGAGG + Intergenic
1185065923 22:48631651-48631673 CAGACTCAGGCGCTGGGAGCAGG + Intronic
1185301622 22:50083974-50083996 CATGCTCAGGCCACGGGAGGTGG + Intronic
1185317035 22:50183746-50183768 CCTGCTTATGCTCAGGGAGGGGG - Intergenic
949518654 3:4829864-4829886 CAGCCTGAGGCTCAGGGGGAGGG - Intronic
949556424 3:5157378-5157400 CAGGCTCAGGACCAGGAAGTGGG - Intronic
950125740 3:10508808-10508830 CAGGGTCAGCCACAGGGAAGAGG + Intronic
950215192 3:11154215-11154237 CGGGCTCGGGCTCTGCGAGGCGG - Intronic
950568480 3:13785876-13785898 GAAGCTGAGGCCCAGGGAGGGGG + Intergenic
950717969 3:14863048-14863070 CAGGCCCTGGCCCAGGCAGGGGG - Intronic
950872541 3:16242190-16242212 CCAGCCCAGGCTCAGGGAGGAGG + Intergenic
952736632 3:36697698-36697720 CAGGTTTAGGGTCAGGGAGCAGG + Intergenic
952879637 3:37975432-37975454 GAGGCCCAGGCTAAGGGTGGTGG + Intronic
952915749 3:38239847-38239869 CAAGCTGTGGCACAGGGAGGTGG - Intronic
953151899 3:40332542-40332564 TAGGCTCAGGGGCAAGGAGGAGG - Intergenic
953570176 3:44065259-44065281 CAGGCTCTGAGTCGGGGAGGTGG - Intergenic
953626912 3:44579300-44579322 CAGGCTCCGCCTCAGGGCGCAGG + Intronic
954312791 3:49783306-49783328 CAGGCCAAGGCTGAGGCAGGTGG + Intronic
954578699 3:51691346-51691368 CCTGCTCTGGCACAGGGAGGAGG + Intronic
954635368 3:52068236-52068258 CTGGCCCAGGCTTGGGGAGGGGG - Intergenic
954698416 3:52439623-52439645 CAGGCTCAGACCCAGAGATGGGG + Intronic
954724177 3:52593337-52593359 AAGGCTGAGGCACAAGGAGGTGG - Intronic
954803997 3:53204715-53204737 CAGGCTGTGGGACAGGGAGGGGG + Intergenic
955403504 3:58610347-58610369 CAGGCTCAGCCTCATGGATGGGG - Intronic
955758989 3:62257853-62257875 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
956249594 3:67221642-67221664 CATGGTCAGGCTCAGGTGGGTGG + Intergenic
957051998 3:75418291-75418313 CAGCAGGAGGCTCAGGGAGGAGG + Intergenic
957070093 3:75561035-75561057 CTGGCTCTGGCTCTGGGAGCTGG - Intergenic
957367152 3:79240753-79240775 CAGGCTGAGGCTGAGGTTGGAGG - Intronic
958785440 3:98592990-98593012 CAGGCTCTGGCACAGGTAGACGG - Exonic
959498513 3:107078623-107078645 CAGACTGAGGCTGAGGCAGGAGG - Intergenic
960141876 3:114158994-114159016 CAGGCTCAGGCAGAGGAAAGGGG + Intronic
961028829 3:123584848-123584870 GAGGCTGGGGCTCGGGGAGGCGG - Intronic
961284019 3:125785697-125785719 CTGGCTCTGGCTCTGGGAGCTGG + Intergenic
961336979 3:126186505-126186527 CAGGCTCAGGGTCAGGGTCAGGG - Intronic
961809453 3:129513602-129513624 CAGGGTAAGGCTCAGGGTAGAGG - Intronic
961830281 3:129619680-129619702 CTGGAGCAGGCTCAGGGAAGGGG + Intergenic
961885606 3:130094523-130094545 CAGCAGGAGGCTCAGGGAGGAGG + Intronic
962152765 3:132910504-132910526 CAGTCTCAGTCTAAGGGAGATGG + Intergenic
962205051 3:133427562-133427584 CTGGCTGAGGAGCAGGGAGGTGG - Intronic
962431470 3:135324336-135324358 AAACCTCAGGCTCAGAGAGGTGG - Intergenic
962742759 3:138374202-138374224 GAGGCTGAGGCTGAGGCAGGCGG - Intronic
963603056 3:147393572-147393594 CCGGCTCAGGGTCGGAGAGGAGG - Intronic
965296782 3:166956916-166956938 CAGGTCCAGGACCAGGGAGGTGG - Intergenic
966525323 3:180913056-180913078 CAGGCCCGAGCTCTGGGAGGTGG + Intronic
967216907 3:187218866-187218888 CAGGGTGAGGCTCAGGGGTGAGG + Intronic
967944991 3:194797337-194797359 CATGCTCAGGCCCTGGGTGGCGG + Intergenic
968472771 4:789664-789686 CAGGCCCGGGCCCAGGGAGCAGG - Intronic
968520167 4:1031543-1031565 CAGGCTGAGGTTCAGGGTGAGGG - Intergenic
968522433 4:1040017-1040039 CAAGCCCAGGTCCAGGGAGGTGG + Intergenic
968557168 4:1251445-1251467 CAGGCCCAGGCACAGGGAGGCGG - Intergenic
968602369 4:1516334-1516356 GAGGCCCAGGCTCAGGGACACGG - Intergenic
968699537 4:2048010-2048032 CAGGCTCAGGCTGAGGCTGTGGG + Intergenic
968904942 4:3446742-3446764 CAGGCCCACACTCTGGGAGGCGG + Intronic
968935254 4:3606955-3606977 TGGGGCCAGGCTCAGGGAGGAGG + Intergenic
968939995 4:3632774-3632796 CAGACTCAGACACAGAGAGGAGG + Intergenic
968940221 4:3633804-3633826 CAGCCTCAGACCCAGGGAGGTGG - Intergenic
968994801 4:3938666-3938688 CAGCGGGAGGCTCAGGGAGGAGG + Intergenic
969013685 4:4088497-4088519 CTGGCTCTGGCTCTGGGAGCTGG - Intergenic
969057911 4:4413629-4413651 TAGCCACAGGCACAGGGAGGCGG + Intronic
969057925 4:4413698-4413720 CAGGCACAGGCCCCTGGAGGAGG + Intronic
969115006 4:4865966-4865988 CGGGCTGCGGCGCAGGGAGGGGG - Intergenic
969153706 4:5191903-5191925 CCGGCACGGGCTGAGGGAGGGGG + Intronic
969276102 4:6136949-6136971 GAAACTGAGGCTCAGGGAGGTGG + Intronic
969369292 4:6721002-6721024 CAGGCCCTGGCCAAGGGAGGCGG - Intergenic
969489035 4:7488392-7488414 CAGTCTCAGGCTGAGGGATGAGG + Intronic
969587403 4:8102314-8102336 CAGGCTGGGCCTCACGGAGGAGG - Intronic
969759201 4:9170128-9170150 CAGCAGGAGGCTCAGGGAGGAGG - Intergenic
969799464 4:9551429-9551451 CTGGCTCTGGCTCTGGGAGCTGG + Intergenic
969819163 4:9707607-9707629 CAGCAGGAGGCTCAGGGAGGAGG - Intergenic
969934458 4:10667030-10667052 CAGAATCTGACTCAGGGAGGAGG - Intronic
973323595 4:48834666-48834688 GAGGCTGAGGCTGAGGTAGGAGG + Intronic
976457361 4:85263785-85263807 CATGCTCAGACTGAGGCAGGTGG + Intergenic
978127163 4:105147824-105147846 CAGGCGCAGGCCCGGGGAGGGGG + Intronic
979311861 4:119212670-119212692 CAGGGTCGGGCTCTGGGCGGCGG + Intronic
981718458 4:147775347-147775369 TAGGCTGAGGCTAATGGAGGTGG + Intronic
983434006 4:167688540-167688562 CTGCCTCAGCCTCAGGGAGCTGG + Intergenic
983509995 4:168598720-168598742 CAGGCTCAGGTCCAGATAGGAGG - Intronic
983544298 4:168946363-168946385 CTTGCTCAGGCTCTGAGAGGAGG - Intronic
983779517 4:171650928-171650950 CATGCTTGGGCTCAGGGAGAGGG - Intergenic
985448438 4:190041345-190041367 CCAGCTCGGGCTCGGGGAGGGGG - Intergenic
985790934 5:1926512-1926534 CAGGGACAGGCTCAGGGGCGGGG - Intergenic
985790956 5:1926576-1926598 CAGGGACAGGCTCAGGGGCGGGG - Intergenic
985819652 5:2151008-2151030 CAGGGTCAGGGTCAGGGCAGTGG + Intergenic
985825222 5:2186214-2186236 CAGCCTCAGGGTCAGGGATAGGG + Intergenic
985871634 5:2562168-2562190 CCGGCACAGGCACAGGAAGGAGG - Intergenic
985890521 5:2711933-2711955 CAGACACAGGCCCGGGGAGGAGG - Intergenic
985931776 5:3064085-3064107 CAGGCTCAGCCTCCTGGTGGAGG - Intergenic
986294264 5:6424169-6424191 CAGACTCAGACTCTGAGAGGGGG - Intergenic
986767030 5:10937607-10937629 CAGGCTCTGGGGAAGGGAGGTGG + Intergenic
986977995 5:13414822-13414844 CTGGCTCAGGCTCTGTGAGCAGG + Intergenic
987050196 5:14142862-14142884 CTGGCCCTGGCTCGGGGAGGGGG - Intergenic
987114250 5:14713823-14713845 TAGGCTCAGGAGCAGGGATGGGG - Intronic
988837348 5:35046302-35046324 CAGTCTTATGCTCAGTGAGGAGG - Intronic
991577021 5:68115253-68115275 CAGACTCAGGCTGGGTGAGGTGG - Intergenic
991726983 5:69545526-69545548 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
991867974 5:71082348-71082370 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
992481023 5:77152725-77152747 CAGGCTCAGCCTCTGTGAAGGGG - Intergenic
992742254 5:79785314-79785336 CAGGAGCAGGCTGATGGAGGAGG - Intronic
992748630 5:79842336-79842358 CAGGATGAGGCCCAGGGAAGAGG - Intergenic
993563407 5:89441198-89441220 GGGGCTGAAGCTCAGGGAGGCGG + Intergenic
993733765 5:91451699-91451721 CCTGCCCAGGCTCAAGGAGGAGG + Intergenic
994138465 5:96316025-96316047 AAGGCTCAGGCTCAGCTGGGTGG - Intergenic
994405095 5:99335131-99335153 TGCGCTCAGCCTCAGGGAGGGGG - Intergenic
995003033 5:107158246-107158268 GGGGCTCAGGCTCAGGGCTGAGG - Intergenic
996886010 5:128354316-128354338 CTGGCTCAGGCTGAGGGGGTGGG + Intronic
997209705 5:132070113-132070135 GGGGTTGAGGCTCAGGGAGGAGG + Intergenic
997296810 5:132773708-132773730 CAAGCTCAGGGCCAAGGAGGAGG - Intronic
997610547 5:135212864-135212886 CAGGCTGAGGCTGGGGGATGGGG - Intronic
997716138 5:136044398-136044420 CAGGCTCAGGCTCAGGCTCTTGG + Intronic
997739079 5:136237992-136238014 CAGCCTCGGGCTCCAGGAGGCGG - Intronic
997792284 5:136771673-136771695 CATGCTCAGGTTCTGGGATGGGG + Intergenic
998076408 5:139240220-139240242 CAGGCTGAGGGTGAGGGTGGGGG + Intronic
999063625 5:148661225-148661247 CAGGGCTAGACTCAGGGAGGAGG + Intronic
999312645 5:150561754-150561776 CAGCCTCAGGCCCAGGGGGCAGG - Intergenic
999312780 5:150562650-150562672 CAGGCTCAGGCTCAGAAATGGGG - Intergenic
999823206 5:155249091-155249113 CAGGCAGCGGCTCAGGGAAGGGG - Intergenic
1000036982 5:157456408-157456430 CAGGCTCAGTCTCCCTGAGGAGG - Intronic
1001017672 5:168156128-168156150 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1001258029 5:170200140-170200162 CAGGCTCGGGCTCAGGACTGAGG - Intergenic
1001650750 5:173314364-173314386 CAGGCTCAGTCTGAGAGAAGGGG + Intergenic
1001670406 5:173468768-173468790 CAGGCCCAGGCCCAGGGATGTGG + Intergenic
1001744948 5:174085286-174085308 GAGACTGAGGCTCAGAGAGGTGG + Intronic
1001965630 5:175908099-175908121 GAAACTGAGGCTCAGGGAGGTGG - Intergenic
1002251318 5:177931096-177931118 GAAACTGAGGCTCAGGGAGGTGG + Intergenic
1002520703 5:179792061-179792083 CAGGCTCAGAGGGAGGGAGGTGG + Intronic
1002594312 5:180312175-180312197 GAGGCTGAGGACCAGGGAGGCGG + Intronic
1004012598 6:11703536-11703558 AAGGCTCGGGCTCAGGAAAGAGG + Intergenic
1004632290 6:17433510-17433532 CAGGCTTAGGCCCAGGGCAGAGG + Intronic
1004979593 6:21008398-21008420 CAGGGTCAGGCCCGTGGAGGTGG + Intronic
1005450410 6:25966566-25966588 CAGGCTCAGGCAGATGGAGCAGG - Exonic
1006106314 6:31719046-31719068 GAGGCTCAGGCCAAGGCAGGTGG + Exonic
1006186140 6:32182687-32182709 GAGGCACAGGCTCTGGGAGTTGG + Exonic
1006269184 6:32950816-32950838 CAGGGTGAGGTTCAGGGAGGTGG + Intronic
1006295584 6:33168663-33168685 GAGGCTTGGGCTCAGGGGGGTGG + Intronic
1006365926 6:33615120-33615142 CAAGTTCAGGCCCAGGAAGGAGG - Intergenic
1006410623 6:33871274-33871296 CTGGCTCAGGCTCCAGAAGGTGG - Intergenic
1006507108 6:34496373-34496395 CAGGCCCAGGCTGAGGGGGGTGG + Intronic
1006601765 6:35231134-35231156 CAAGCCCAGGCACAGGGGGGAGG + Intronic
1006778668 6:36616925-36616947 GAGCCTGAGGCCCAGGGAGGAGG + Intergenic
1006802164 6:36766152-36766174 CAGGGTCAGGTTTGGGGAGGTGG + Intronic
1006913897 6:37582433-37582455 GAGGCTCCGGCCCAGGGCGGGGG - Intergenic
1007382503 6:41499825-41499847 AAGTCCCAGGCTCAGGGAAGGGG - Intergenic
1007614198 6:43171034-43171056 CATTCTCGGGTTCAGGGAGGCGG + Intergenic
1007693213 6:43716152-43716174 CAGGCCCAGGCCCTGGGAGCTGG - Intergenic
1007819651 6:44551888-44551910 CAGGCTCTGGCTCAGAATGGAGG - Intergenic
1009624738 6:66125590-66125612 CATGCTCAGGCTCAGATAAGAGG - Intergenic
1009979405 6:70709444-70709466 CAGTCGCAGGCTCAGGTGGGAGG - Intronic
1012512871 6:100024755-100024777 CAGGCCATGGCTCATGGAGGGGG + Intergenic
1013392790 6:109703688-109703710 CAGTCTCAGGGACAGAGAGGGGG - Intronic
1014546974 6:122745988-122746010 CTGGCTTAGGCACAGGCAGGAGG + Intergenic
1014914205 6:127125805-127125827 TAGGCTCAGGGTTAGGGAGCTGG + Intronic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017690307 6:156957378-156957400 CAGGGTCAGCTTCAGGTAGGAGG + Intronic
1017818567 6:158032433-158032455 CATACTCACTCTCAGGGAGGAGG - Intronic
1018790193 6:167142372-167142394 CAGGTGCAGGCGCTGGGAGGCGG - Intergenic
1018842319 6:167526297-167526319 CTGGCGCAGGCTCAGGGGTGAGG - Intergenic
1019302693 7:316049-316071 CAGGACATGGCTCAGGGAGGCGG - Intergenic
1019543095 7:1560246-1560268 CAGGGACAGGAGCAGGGAGGTGG - Intronic
1019609337 7:1929082-1929104 CCTGCTCGGCCTCAGGGAGGAGG - Intronic
1019651056 7:2158847-2158869 CAGGTGCAGCCTCAGGCAGGTGG - Intronic
1019845070 7:3490761-3490783 CAGTCTCAGGCTATTGGAGGGGG + Intronic
1019979863 7:4613650-4613672 CAGACTCAGGCAAAGGGAGCGGG - Intergenic
1020319063 7:6926989-6927011 CAGCAGGAGGCTCAGGGAGGAGG + Intergenic
1021226722 7:18036577-18036599 CAGGCTCAGGCTGGGAGCGGTGG - Intergenic
1021958898 7:25852920-25852942 AAGGCCCAGGCACAGGGCGGCGG - Intergenic
1022105233 7:27192265-27192287 CTGGCTGAGCCGCAGGGAGGGGG + Intergenic
1022143370 7:27512871-27512893 AAGACTCAGGGACAGGGAGGTGG + Intergenic
1022548425 7:31211203-31211225 CAGGCTCTGGCTCAGTGCAGTGG + Intergenic
1022666610 7:32416723-32416745 AAGGCTCAGGCTCAGGATGGGGG + Intergenic
1022943155 7:35258253-35258275 TGGCCTCAGGCTCAGGGCGGCGG + Intergenic
1023078585 7:36506823-36506845 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
1023871753 7:44266973-44266995 CAGGCTCAGGCTCAGGCTCACGG + Intronic
1024284451 7:47744965-47744987 GAAGCTGAGTCTCAGGGAGGAGG + Intronic
1024667565 7:51561993-51562015 GAGGGTGAGGCTCTGGGAGGAGG + Intergenic
1026140249 7:67699470-67699492 CGGTGGCAGGCTCAGGGAGGAGG + Intergenic
1026341099 7:69434690-69434712 GAGGCTCTGGCTCATGGAGGGGG - Intergenic
1026817584 7:73524100-73524122 GAGACTCCGTCTCAGGGAGGCGG + Intergenic
1026975484 7:74495252-74495274 CAGGCCCAGGCTCTGGGCTGAGG + Intronic
1029072336 7:97910124-97910146 CTGGCTCTGGCTCTGGGAGCTGG - Intergenic
1029113777 7:98226466-98226488 CAAGGCCAGGCACAGGGAGGTGG - Intronic
1029203709 7:98855773-98855795 CCGGCTCAGGCTCTGGGAGCAGG + Intronic
1029415780 7:100442317-100442339 CAGGCTCAGGGTCAGTGTGTTGG - Intergenic
1029440600 7:100584900-100584922 GGGGATCAGGATCAGGGAGGAGG - Intronic
1029536949 7:101162819-101162841 CGGGCTCAGGACCCGGGAGGGGG + Exonic
1029627250 7:101727723-101727745 CAGCCTCTGGCCCTGGGAGGAGG + Intergenic
1029715718 7:102324406-102324428 CAGGCGCAGGAGCAGCGAGGTGG + Intergenic
1031233956 7:119147822-119147844 CTGGCTCAGAATCAGGGATGGGG + Intergenic
1032469632 7:132168970-132168992 TAGTCCCAGGCTCAGGGATGGGG - Intronic
1032968346 7:137129633-137129655 CAGGCTTTGGCACAGAGAGGAGG + Intergenic
1033216220 7:139495541-139495563 CAGGCACAGGCTCTAGGAGAGGG - Intergenic
1033220833 7:139525242-139525264 CAGGCTCGAGGTCAGGGAGGGGG + Intronic
1033282230 7:140014407-140014429 CAGGCTGGGGCTGAGGTAGGAGG + Intronic
1034160242 7:148988683-148988705 CAGGCTCAGAGGCAGGGAAGGGG + Intergenic
1034834341 7:154337772-154337794 AAGGCTCACGCCCAGGGAGAAGG + Intronic
1035056477 7:156039716-156039738 CATGCCCAGGCTCTGGGAAGTGG + Intergenic
1035179287 7:157077708-157077730 GAGGCTGAGGCTGAGGCAGGAGG - Intergenic
1035214014 7:157351175-157351197 GTGGCTCAGGCTGAGGGGGGCGG - Intronic
1035393556 7:158521561-158521583 CAGGTACTGGCTCAGGGGGGAGG + Intronic
1035469291 7:159099525-159099547 CAGGCTGGGGCTCAGAAAGGAGG + Intronic
1036245326 8:7111177-7111199 CTGGCTCTGGCTCTGGGAGCTGG + Intergenic
1036381344 8:8238159-8238181 CAGCAGGAGGCTCAGGGAGGAGG - Intergenic
1036488126 8:9198549-9198571 CAGTCTCTGGCTGTGGGAGGTGG + Intergenic
1036618017 8:10403761-10403783 CAGGCTCAGGCTGAGGCAGACGG + Intronic
1036752641 8:11453031-11453053 CAGGCTCAGGCTGAGGGGTCAGG - Intronic
1036754472 8:11463424-11463446 CAGGCTCATGCTTAGGGTGGTGG - Intronic
1036847314 8:12178833-12178855 CAGCAGGAGGCTCAGGGAGGAGG + Intergenic
1036868678 8:12421154-12421176 CAGCAGGAGGCTCAGGGAGGAGG + Intergenic
1037174791 8:15933991-15934013 GAGGCTCTGCTTCAGGGAGGTGG - Intergenic
1037272367 8:17144062-17144084 CAGTGTCAGGCTGAGGGAGGTGG + Intergenic
1037957752 8:23071985-23072007 CTGCCTCAAGCTCAGGGAGCTGG - Intergenic
1037968628 8:23154886-23154908 GAGGCGCAGCCTCAAGGAGGAGG - Exonic
1038415588 8:27392836-27392858 AAGCCTCAGGCCCAGGAAGGTGG - Intronic
1038520163 8:28225352-28225374 CTGGCTCAGGCTAAGTGTGGTGG - Intergenic
1039052697 8:33509213-33509235 GAGGCTGAGGCTGAGGCAGGTGG + Intronic
1039839881 8:41285836-41285858 CAGGCTCAGGCTAGGGTCGGGGG + Intronic
1040420830 8:47239119-47239141 CAGGCTCAGGGTCATGGTGAGGG + Intergenic
1041367007 8:57117158-57117180 CAGGATCAAGCTGAGGGAGAGGG - Intergenic
1042952743 8:74218632-74218654 ACGACTGAGGCTCAGGGAGGGGG - Intergenic
1042963803 8:74329886-74329908 CAGGCTGAGGCTCTGTGGGGAGG - Intronic
1045008832 8:97939539-97939561 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
1045630004 8:104107817-104107839 CATGCCAAGGCTGAGGGAGGAGG + Intronic
1046119861 8:109832287-109832309 CAGGCTTTTGCTCAGGAAGGTGG + Intergenic
1048014726 8:130487026-130487048 CATGCTCAGGCTTTGGAAGGTGG + Intergenic
1048807709 8:138255869-138255891 CAGGGTCAGGCACAGTAAGGAGG - Intronic
1049236125 8:141513270-141513292 CAGCCTCAGACTTAGGAAGGTGG - Intergenic
1049360569 8:142210787-142210809 CATGATGAGGCTGAGGGAGGAGG - Intergenic
1049529245 8:143146258-143146280 CAGGCAAAAGCTCATGGAGGAGG - Intergenic
1049738527 8:144222799-144222821 CAGGCCCAGGCCCAGGTATGTGG + Intronic
1049949352 9:629272-629294 AAGCCTCAGCCTGAGGGAGGGGG - Intronic
1050609606 9:7337750-7337772 CAGGCTTTGGCTCAGGGGAGAGG + Intergenic
1050992321 9:12170021-12170043 ATTGCTCAGCCTCAGGGAGGAGG + Intergenic
1052022146 9:23537892-23537914 CATGCTAAGGGTAAGGGAGGGGG + Intergenic
1052324096 9:27198380-27198402 CAGCCTCAGACTCTGGGAGGTGG - Intronic
1052569146 9:30198793-30198815 CAGGCTGCAGCCCAGGGAGGAGG + Intergenic
1053266100 9:36714573-36714595 GTGGCCCAGGCTCAGGGTGGGGG + Intergenic
1053266103 9:36714579-36714601 CAGGCTCAGGGTGGGGGAAGTGG + Intergenic
1053404173 9:37856706-37856728 GAGGCTGAGGCTGAGGCAGGAGG + Intronic
1053751954 9:41266195-41266217 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1054257477 9:62830525-62830547 CAGCCTCAGGCGCAGGAGGGAGG + Intergenic
1054450536 9:65401493-65401515 CAGCCTCAGACCCAGGGAGGTGG + Intergenic
1054450758 9:65402504-65402526 CAGACTCAGACACAGAGAGGAGG - Intergenic
1054454930 9:65424947-65424969 TGGGGCCAGGCTCAGGGAGGAGG - Intergenic
1054800896 9:69347237-69347259 GATGCTCAGGCTAAGGGAGCTGG + Intronic
1055367169 9:75556913-75556935 GAGTCTAAGGCTCAGGGAAGTGG + Intergenic
1056887050 9:90453223-90453245 CAGGCTCAGGCTTAGGAACATGG - Intergenic
1057034801 9:91804225-91804247 CAGGCTCAGGAACTGGCAGGAGG + Intronic
1057146298 9:92761490-92761512 TGAGCTCAGGCTCAGAGAGGAGG - Intronic
1057196154 9:93116453-93116475 CAGGTTCAGAATCTGGGAGGGGG + Intergenic
1057900310 9:98943514-98943536 GAGACTGAGGCTCAGAGAGGTGG - Intronic
1060069176 9:120531474-120531496 GAGGCACAGGCTCAGAGAGATGG - Intronic
1060439686 9:123627060-123627082 CATGCACAGGCTCAGGGATGGGG - Intronic
1060776679 9:126379805-126379827 CTGTCACAGGCTCAGGGCGGAGG - Intronic
1061055949 9:128223013-128223035 CAGGCTCCAGCTTGGGGAGGTGG + Intronic
1061591116 9:131598198-131598220 CAGGCTGACGCTCAAGCAGGAGG - Exonic
1061747914 9:132753589-132753611 CTGGCACAGGCTCAGGCTGGTGG + Intronic
1061961277 9:133990541-133990563 CAGGCTGGGGCTCAGGGCAGAGG - Intronic
1062016365 9:134293217-134293239 CAGGCTGGGGCTCCTGGAGGGGG + Intergenic
1062196894 9:135279406-135279428 GAAGCTGAGGCTCAGAGAGGTGG + Intergenic
1062255492 9:135618941-135618963 CAGACCTAGGCTCAGGGTGGGGG - Intergenic
1062315737 9:135966307-135966329 GAGGCTGAGGCTGAGGGATGGGG - Intergenic
1062396856 9:136356059-136356081 CAGGGGCAGTCTCAGGGAGGGGG + Intronic
1062403534 9:136382861-136382883 CAGGCTCACGAGGAGGGAGGAGG + Intronic
1062479370 9:136744311-136744333 CAGGGTGAGGCTCAGGATGGCGG + Intronic
1062536948 9:137025274-137025296 CAGCCCCCAGCTCAGGGAGGAGG + Intronic
1062567468 9:137169725-137169747 CAGGCGCAGGCTCAGGCCCGGGG + Exonic
1062733367 9:138121262-138121284 CAGGGTCAGGCCCAGGAATGGGG - Intronic
1185847860 X:3456671-3456693 CAGGCACAGGCTGGGGGGGGGGG - Intergenic
1185909734 X:3970663-3970685 CTGGCTTAGGGACAGGGAGGAGG - Intergenic
1186911677 X:14174180-14174202 CAGGCTCAGCCACAGGGGGGTGG - Intergenic
1188385096 X:29546769-29546791 AAGGCTCAGGCTCATGGAAATGG - Intronic
1188768512 X:34125877-34125899 CAGGCTCAGGGGCAGGGTGCTGG + Intergenic
1189114368 X:38327629-38327651 CAGGCTCAGGCACAGCGGAGGGG + Intronic
1189147166 X:38667030-38667052 CATGGCCAGGCTCAAGGAGGTGG - Intronic
1190055178 X:47177306-47177328 GAAGCTGAGGCTCAGAGAGGTGG + Intronic
1192094640 X:68197749-68197771 CTGGCTAAGACACAGGGAGGAGG + Intronic
1192577530 X:72255028-72255050 CAGGCACCGGCTCAGGGCGGGGG + Intronic
1195217575 X:102715499-102715521 CAGGCCCAGGGCCAGAGAGGAGG + Exonic
1195217624 X:102715781-102715803 CAGGCCCAGAGTCAGGGAGGAGG + Exonic
1195664899 X:107420291-107420313 CAGCCTCATCCTCAGGGAGCTGG + Intergenic
1196630747 X:117936689-117936711 CAGGCTCTGGCTATGGGATGTGG - Intronic
1197724501 X:129767713-129767735 AAGGCCCAGGGTCAGGGAGAAGG - Intronic
1198214912 X:134546544-134546566 CCGGCTCAGGAGCAGGTAGGTGG - Intergenic
1198416883 X:136429380-136429402 CAGGGGCAGGAGCAGGGAGGTGG - Intergenic
1199269321 X:145864410-145864432 CAGGATCAGGTTGAGAGAGGTGG + Intergenic
1199607174 X:149586367-149586389 CGGGCCCAGGCTCTGTGAGGAGG - Intronic
1199607298 X:149586807-149586829 CGGGCCCAGGCTCTGTGAGGAGG - Intronic
1199615603 X:149652594-149652616 CAGGCCCCGGCTCTGTGAGGAGG - Intergenic
1199622357 X:149712570-149712592 CGGGCCCAGGCTCTGTGAGGAGG + Intronic
1199628851 X:149762357-149762379 CGGGCCCAGGCTCTGTGAGGAGG - Intergenic
1199631825 X:149782560-149782582 CGGGCCCAGGCTCTGTGAGGAGG + Intronic
1199631950 X:149783001-149783023 CGGGCCCAGGCTCTGTGAGGAGG + Intronic
1199642896 X:149881259-149881281 CGGGCTCAGGGTCTGTGAGGAGG + Exonic
1199756948 X:150873814-150873836 CAGGCTCAGGCCCTGGTTGGAGG - Intronic
1199872540 X:151912516-151912538 CAGGCGCAGGCTCTGTGAGGAGG + Intronic
1199897560 X:152138479-152138501 CGGGCCCAGGCTCTGTGAGGAGG - Exonic
1199949795 X:152698803-152698825 CCGGCCCAGGCTCGGTGAGGAGG + Exonic
1199951983 X:152714656-152714678 CAGGCGCAGGCTCCGTGAGGAGG + Exonic
1199954622 X:152733833-152733855 CAGGCGCAGGCTCCGTGAGGAGG + Intronic
1199957700 X:152753792-152753814 CAGGCGCAGGCTCCGTGAGGAGG - Exonic
1199959879 X:152769658-152769680 CCGGCCCAGGCTCGGTGAGGAGG - Exonic
1200079056 X:153566550-153566572 GAGGCTGAGGCCCAGGGAGTGGG - Intronic
1200143854 X:153915676-153915698 CAGGAGGAGGCTCAGGCAGGAGG + Intronic
1200400861 X:156019923-156019945 CAGGGTCAGGGTCAGGGTGAGGG + Intergenic
1200400877 X:156019977-156019999 CAGGGTCAGGGTCAGGGTGAGGG + Intergenic
1200943186 Y:8806237-8806259 CAGTCTCAGGGACAGGCAGGAGG - Intergenic