ID: 1075420093

View in Genome Browser
Species Human (GRCh38)
Location 10:122294261-122294283
Sequence TGATGCTATCAGAGTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075420093_1075420096 9 Left 1075420093 10:122294261-122294283 CCCAGGTCACTCTGATAGCATCA 0: 1
1: 1
2: 0
3: 13
4: 143
Right 1075420096 10:122294293-122294315 GGTGCTGAGTGAGACCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075420093 Original CRISPR TGATGCTATCAGAGTGACCT GGG (reversed) Intronic
901078015 1:6567595-6567617 TGATACTAGCAGAGTTACCCTGG + Intronic
901218295 1:7567062-7567084 TGAGGCCAGCTGAGTGACCTTGG + Intronic
903172926 1:21564691-21564713 TGTTGCTAGCTGTGTGACCTTGG + Intronic
906695537 1:47820916-47820938 TGCTACTACCTGAGTGACCTTGG - Intronic
907750841 1:57261711-57261733 ACATGCTAGCAGAGTGACTTTGG + Intronic
908776264 1:67643380-67643402 TGAATCTTTCTGAGTGACCTTGG + Intergenic
910241728 1:85093901-85093923 TTATGCCATCTGGGTGACCTGGG - Intronic
910729433 1:90376714-90376736 CATTGCTAACAGAGTGACCTTGG - Intergenic
910753764 1:90663523-90663545 TGATGCTAATACAGTGAGCTAGG - Intergenic
915699733 1:157780355-157780377 TAATTCTCTCATAGTGACCTTGG - Intergenic
915897818 1:159825137-159825159 AGATGCCATCAGGGTGAGCTAGG - Intergenic
916493871 1:165327391-165327413 TGTTGGGATCAGGGTGACCTGGG - Intronic
917160239 1:172049246-172049268 TGATACTTTCTGTGTGACCTTGG + Intronic
917483476 1:175433363-175433385 TGATGCTTTGAGGGTGACCTGGG + Intronic
919027665 1:192198723-192198745 TGATGCTACCAAAGCAACCTTGG - Intergenic
919177162 1:194033391-194033413 TACTGCTATCTGAGTGACATTGG + Intergenic
921925349 1:220706423-220706445 TGATATTGTCAGAGTGGCCTTGG - Intergenic
1066239344 10:33518177-33518199 TGATGTTAACAGAGTGACTTTGG - Intergenic
1068004535 10:51377244-51377266 TCTTGCTACCAGTGTGACCTTGG + Intronic
1068529249 10:58166184-58166206 TGATACTATCAGAGAGCCTTGGG + Intergenic
1069001415 10:63270804-63270826 TGATGATATGAGACTGACTTTGG + Intronic
1072706648 10:97685927-97685949 TGCTGCTAACTGGGTGACCTTGG + Intronic
1074889158 10:117720855-117720877 TGATGCACTCACAGTGACCAGGG - Intergenic
1075420093 10:122294261-122294283 TGATGCTATCAGAGTGACCTGGG - Intronic
1077712054 11:4547201-4547223 TATTGCTCTCTGAGTGACCTTGG - Intergenic
1080252462 11:30249474-30249496 TGATGTTGTCAGAGGGACCATGG - Intergenic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083198744 11:61106560-61106582 TGATGGTGACAGAGTGACCCAGG - Intronic
1083332821 11:61906894-61906916 TCCTGCTCACAGAGTGACCTTGG - Intronic
1085689412 11:78653172-78653194 GGCTGCTATCAGGATGACCTGGG - Exonic
1086534533 11:87829068-87829090 TGATGTTTTCAGATTAACCTAGG + Intergenic
1088452200 11:109994198-109994220 TGATACTAGCTGTGTGACCTTGG + Intergenic
1088535053 11:110851520-110851542 TGATGCTAATATAGTGACCTAGG + Intergenic
1090953181 11:131492060-131492082 AGGTGCCAGCAGAGTGACCTAGG - Intronic
1091359995 11:134971602-134971624 TGATGGTTTCAGCCTGACCTTGG + Intergenic
1093800413 12:23365300-23365322 TGATGATTTCAGATTGACCCAGG - Intergenic
1096189258 12:49604593-49604615 ACATGCTAGCAGCGTGACCTTGG + Intronic
1099286633 12:80720724-80720746 TGATGCTAACAGAGTGACAGTGG - Intergenic
1099977190 12:89558227-89558249 AGAAAATATCAGAGTGACCTGGG + Intergenic
1100170955 12:91974619-91974641 TTTTGCTAACAGTGTGACCTGGG - Intergenic
1101038742 12:100732746-100732768 ACATGCTGTCAGTGTGACCTTGG + Intronic
1101498426 12:105278140-105278162 TCATGATCTCAGAGTGGCCTTGG + Intronic
1103043373 12:117714591-117714613 TGCTGCTAGCTGTGTGACCTTGG - Intronic
1103799962 12:123531897-123531919 TCAGGCTCCCAGAGTGACCTCGG + Intronic
1104585940 12:130048097-130048119 TGATGTTTTCATAGTGCCCTAGG - Intergenic
1107578249 13:41750955-41750977 TGAAGCTAGCTGTGTGACCTTGG + Intronic
1111352451 13:87048925-87048947 TGATGCTTTTTGAGAGACCTGGG + Intergenic
1116210092 14:41927599-41927621 TAATGCTCACAGAGTGACCTGGG - Intergenic
1116303768 14:43221424-43221446 TGATGCTATCAGATTCATATAGG + Intergenic
1118737094 14:68709337-68709359 TGGTGGTGTCTGAGTGACCTTGG - Intronic
1119906123 14:78303657-78303679 GGATGCAAGCAGAGTGACTTTGG - Intronic
1120858478 14:89233754-89233776 TGCTACTAGCAGAGTGACCTCGG + Intronic
1121631076 14:95422407-95422429 TGAGCCTATCTGTGTGACCTTGG - Intronic
1124006792 15:25801199-25801221 TGATGCTGGCTGAGTGGCCTTGG - Intronic
1126578865 15:50224010-50224032 ATATGCTAGCTGAGTGACCTTGG + Intronic
1127518741 15:59722136-59722158 TGATGCAGTCAGAGTGACACAGG - Intergenic
1130194149 15:81763321-81763343 TAATGCTAGCTGTGTGACCTTGG + Intergenic
1130306548 15:82715483-82715505 TGCTGCTGTCAGACTGGCCTGGG - Intergenic
1133564906 16:6984333-6984355 TGATGGTATCAATGTCACCTGGG + Intronic
1134008771 16:10835678-10835700 TGATTCTAACAGAGGGAGCTGGG + Intergenic
1134158294 16:11862308-11862330 TCATGGTATCAGTGAGACCTGGG - Intergenic
1136006942 16:27337221-27337243 GGATGCTCTCCGAGTGACTTGGG - Intronic
1136123846 16:28161774-28161796 TTATGCTAGCAGAGGGACTTGGG - Intronic
1137624998 16:49901949-49901971 TGATGCTATCCCACTGATCTGGG - Intergenic
1137923623 16:52517728-52517750 CCATACTTTCAGAGTGACCTTGG - Intronic
1138516511 16:57538243-57538265 TGATGTTATCTTAGTTACCTAGG + Intergenic
1139265752 16:65636726-65636748 TGATACTAGCAGTTTGACCTTGG - Intergenic
1142544229 17:687856-687878 TGCTGTTATCTGTGTGACCTTGG - Intronic
1145823360 17:27857639-27857661 TCCTGGCATCAGAGTGACCTGGG - Intronic
1146921547 17:36716122-36716144 TGATGCTGTCAGAGAGAGCTTGG + Intergenic
1148637372 17:49159032-49159054 AGAAGCTGTCAGGGTGACCTAGG - Exonic
1150050660 17:61958973-61958995 TGATGGAGTCAGAGAGACCTGGG - Intronic
1150788153 17:68179212-68179234 TGCTGCATACAGAGTGACCTGGG + Intergenic
1151831032 17:76550996-76551018 TGATTCTAGCTGAGTAACCTTGG - Intronic
1153686978 18:7556166-7556188 CCTTGCTATCAGTGTGACCTTGG - Intergenic
1154495118 18:14950407-14950429 TGATGGTTTCAGCCTGACCTTGG - Intergenic
1158887317 18:61840511-61840533 TGATGCAATCAGATAGAACTAGG - Intronic
1163526647 19:17825425-17825447 TAATGGTATCTGAGTGTCCTAGG - Exonic
1168684240 19:58338286-58338308 AGCTGCAAGCAGAGTGACCTGGG + Exonic
926536909 2:14124371-14124393 TCATGCCATCAGAGACACCTTGG + Intergenic
928002514 2:27537327-27537349 GGATGCTGTCAGATTTACCTTGG + Intergenic
935990244 2:108712810-108712832 TGATGGTATCAGGGACACCTCGG + Intergenic
937840501 2:126519682-126519704 GGATACTAACAAAGTGACCTGGG + Intergenic
941005478 2:160242994-160243016 TGAAGCAGTCAGAATGACCTTGG + Intronic
943851022 2:192723043-192723065 AGCTGCTATTAGAGTTACCTTGG + Intergenic
944562294 2:200952702-200952724 TGATGCTATCTGAGTGTAGTAGG - Intronic
1169895237 20:10498304-10498326 TTCTGCTAACAGATTGACCTAGG - Intronic
1170743930 20:19081623-19081645 TGATGCTGTCTGAGTGAGATGGG - Intergenic
1170834052 20:19868672-19868694 GGAGGCTGTCAGAGGGACCTTGG + Intergenic
1171488506 20:25500447-25500469 TGATGATCTCAGAGTGAGCCCGG - Intronic
1172154268 20:32812668-32812690 TGCTGCTAGCTGGGTGACCTTGG - Intergenic
1173760723 20:45557958-45557980 TCATGATCTCAGAGTGACGTTGG - Intronic
1173848265 20:46201499-46201521 TGATTCTACCTGTGTGACCTTGG + Intronic
1174305663 20:49612581-49612603 CCCTGCTAGCAGAGTGACCTTGG + Intergenic
1180594945 22:16966999-16967021 TGAAGCTATCAGAGTGACCTTGG + Intronic
1181386731 22:22551182-22551204 TGTTGCTAGCACAGTGACTTTGG - Intronic
1182370159 22:29805073-29805095 GGCTGCCATCAGAGTGTCCTGGG + Intronic
949369000 3:3314348-3314370 TGATTCCATCTGCGTGACCTAGG - Intergenic
951058812 3:18180106-18180128 TGTTACCATCAGAGTGACATAGG + Intronic
954431397 3:50472702-50472724 TGTACCCATCAGAGTGACCTGGG + Intronic
954814044 3:53266472-53266494 TTATGCTAACACAGTGACTTGGG - Intergenic
954958025 3:54538956-54538978 TGCTGCTAACTGTGTGACCTTGG + Intronic
954977218 3:54707531-54707553 TGATGGTTTCAGATTGACATTGG + Intronic
955629640 3:60959173-60959195 TGGTGCTATCAGGCAGACCTAGG + Intronic
962970646 3:140398679-140398701 TTATGCTGTCAAAGTGACCTTGG + Intronic
964806591 3:160617012-160617034 GGATGGTAACAAAGTGACCTCGG + Intergenic
968324417 3:197800136-197800158 TGGTGCGATCAGCGTGATCTTGG - Intronic
969933806 4:10660927-10660949 TGATGCTATCAAAGTCATATAGG - Intronic
970027620 4:11640234-11640256 TGATACTATCTGTGTGACTTTGG - Intergenic
970158222 4:13163160-13163182 TGGTGCTATCAGTGTGGGCTGGG - Intergenic
976269636 4:83218013-83218035 TGAAGCTCTCAAAGGGACCTTGG + Intergenic
976395226 4:84548226-84548248 TGTTGCTACCAGGGTGAACTAGG - Intergenic
977117397 4:93047844-93047866 TTAAGTCATCAGAGTGACCTAGG - Intronic
978612915 4:110564336-110564358 TTTTGAAATCAGAGTGACCTGGG + Exonic
979556654 4:122055654-122055676 TGATGCTGACAGGGTGAACTCGG - Intergenic
981691477 4:147514224-147514246 TGTTGCTAACTGTGTGACCTTGG - Intronic
982808946 4:159802430-159802452 AGATGCTATAAGAGTAAACTGGG - Intergenic
988134163 5:27147741-27147763 TGATGCTATTAGAATGATATAGG + Intergenic
990640795 5:57781513-57781535 TAGAGCTATCAGAGAGACCTTGG - Intergenic
991675029 5:69082237-69082259 TGATGTTATCAGAGGCACCCAGG + Intergenic
992220798 5:74570807-74570829 TTTTGGTATCAGAGTGATCTTGG + Intergenic
992450422 5:76871123-76871145 TGATGCTACCAGAGTGAGGTTGG - Intronic
996465822 5:123801659-123801681 TTATACTATTAGAATGACCTGGG + Intergenic
996525174 5:124472067-124472089 CAATCCTATCTGAGTGACCTTGG + Intergenic
997696193 5:135862940-135862962 TGATGCAATCAGAGTGGTGTTGG + Intronic
999627616 5:153536935-153536957 TTATGCTAACAGACAGACCTTGG + Intronic
1000463501 5:161548681-161548703 TCATGCCATCTGAGTGACCTTGG - Intronic
1001957339 5:175857067-175857089 GGATGCTATCAGACTGAGATGGG - Intronic
1003804216 6:9707431-9707453 TGATTTTATCATAGTGACTTAGG - Intronic
1005188801 6:23194084-23194106 TCATTCTATCAGAGAGACCCAGG + Intergenic
1006622114 6:35372788-35372810 TGACCCTATCTCAGTGACCTTGG + Intronic
1008694344 6:54016617-54016639 TGATGATATCAGTGTGACAGAGG + Intronic
1008895530 6:56549916-56549938 TGACACTATCCGTGTGACCTTGG + Intronic
1015334840 6:132025157-132025179 ATTTGCTATCAGTGTGACCTTGG - Intergenic
1019522024 7:1465345-1465367 TGGTGCTATCTCAGTGATCTCGG + Intergenic
1022460736 7:30603586-30603608 AGATGTTATCAGAGTAACCTAGG + Intronic
1024937609 7:54727117-54727139 TGATGCCCTTTGAGTGACCTTGG - Intergenic
1030216448 7:107047882-107047904 TATTGATATCAGAATGACCTGGG - Intronic
1030520854 7:110596125-110596147 GGATGATATAAGAATGACCTGGG - Intergenic
1033020492 7:137719601-137719623 TATTGCTATCAGAATCACCTGGG + Intronic
1037396766 8:18451728-18451750 TGATACTGTCACAGTTACCTAGG + Intergenic
1038737088 8:30180266-30180288 TGCTGCTATTTGTGTGACCTTGG - Intronic
1043912133 8:85875411-85875433 TGATGATATTAGTGTGGCCTTGG - Intergenic
1045746115 8:105424293-105424315 TGATGCTATCAAAGTTGCTTTGG + Intronic
1046044705 8:108949825-108949847 GGAGGCAATCAGACTGACCTGGG - Intergenic
1053013927 9:34651217-34651239 TATGGCTCTCAGAGTGACCTGGG + Exonic
1056030353 9:82546898-82546920 AGATGCTAGCATACTGACCTTGG + Intergenic
1056106641 9:83353632-83353654 TGATTCTGTCAGAGGGACCAAGG - Intronic
1060276799 9:122188602-122188624 TCAGGCCAACAGAGTGACCTTGG + Intronic
1061801264 9:133114550-133114572 GTCTGCTAACAGAGTGACCTAGG - Intronic
1187221008 X:17325990-17326012 TGATAGAATCAGACTGACCTGGG - Intergenic
1187931417 X:24296816-24296838 GGCTGGTATCAGAGTCACCTGGG + Intergenic
1194777101 X:97978658-97978680 TGCTGCTATCAAAATCACCTTGG - Intergenic
1195659164 X:107361454-107361476 TGTTTCTATCAGAATGACTTAGG - Intergenic
1196110705 X:111944133-111944155 TGTAGCTAACAGTGTGACCTTGG - Intronic
1199590977 X:149468231-149468253 TGACCCCATCTGAGTGACCTTGG - Intergenic
1200259598 X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG + Intergenic
1200832356 Y:7699477-7699499 TGTTTCTTGCAGAGTGACCTGGG - Intergenic