ID: 1075423983

View in Genome Browser
Species Human (GRCh38)
Location 10:122327552-122327574
Sequence GACCCTGGTCTGCCTGCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075423974_1075423983 13 Left 1075423974 10:122327516-122327538 CCGGTCACAGGACTGTGGCTGGC 0: 1
1: 0
2: 0
3: 22
4: 220
Right 1075423983 10:122327552-122327574 GACCCTGGTCTGCCTGCCTCGGG No data
1075423972_1075423983 14 Left 1075423972 10:122327515-122327537 CCCGGTCACAGGACTGTGGCTGG 0: 1
1: 0
2: 2
3: 24
4: 294
Right 1075423983 10:122327552-122327574 GACCCTGGTCTGCCTGCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075423983 Original CRISPR GACCCTGGTCTGCCTGCCTC GGG Intronic
No off target data available for this crispr