ID: 1075427463

View in Genome Browser
Species Human (GRCh38)
Location 10:122352972-122352994
Sequence GCACCCTTATCTGCTGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075427462_1075427463 -8 Left 1075427462 10:122352957-122352979 CCATCTGGCTTCAGGGCACCCTT No data
Right 1075427463 10:122352972-122352994 GCACCCTTATCTGCTGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075427463 Original CRISPR GCACCCTTATCTGCTGCATC AGG Intergenic
No off target data available for this crispr