ID: 1075428820

View in Genome Browser
Species Human (GRCh38)
Location 10:122363900-122363922
Sequence CTACAGCAGGACACCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075428814_1075428820 17 Left 1075428814 10:122363860-122363882 CCAAATGAGGCAGAGGTGTAGAG No data
Right 1075428820 10:122363900-122363922 CTACAGCAGGACACCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075428820 Original CRISPR CTACAGCAGGACACCTGTGT TGG Intergenic
No off target data available for this crispr