ID: 1075429523

View in Genome Browser
Species Human (GRCh38)
Location 10:122368907-122368929
Sequence GCGTGCCTTCCCTGACCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075429523_1075429531 27 Left 1075429523 10:122368907-122368929 CCAGGGGGTCAGGGAAGGCACGC No data
Right 1075429531 10:122368957-122368979 TCTAAGGGCAGGTAGGTTGTAGG No data
1075429523_1075429530 20 Left 1075429523 10:122368907-122368929 CCAGGGGGTCAGGGAAGGCACGC No data
Right 1075429530 10:122368950-122368972 CTGTTAGTCTAAGGGCAGGTAGG No data
1075429523_1075429524 11 Left 1075429523 10:122368907-122368929 CCAGGGGGTCAGGGAAGGCACGC No data
Right 1075429524 10:122368941-122368963 CTGCCCCTGCTGTTAGTCTAAGG No data
1075429523_1075429533 29 Left 1075429523 10:122368907-122368929 CCAGGGGGTCAGGGAAGGCACGC No data
Right 1075429533 10:122368959-122368981 TAAGGGCAGGTAGGTTGTAGGGG No data
1075429523_1075429532 28 Left 1075429523 10:122368907-122368929 CCAGGGGGTCAGGGAAGGCACGC No data
Right 1075429532 10:122368958-122368980 CTAAGGGCAGGTAGGTTGTAGGG No data
1075429523_1075429529 16 Left 1075429523 10:122368907-122368929 CCAGGGGGTCAGGGAAGGCACGC No data
Right 1075429529 10:122368946-122368968 CCTGCTGTTAGTCTAAGGGCAGG No data
1075429523_1075429525 12 Left 1075429523 10:122368907-122368929 CCAGGGGGTCAGGGAAGGCACGC No data
Right 1075429525 10:122368942-122368964 TGCCCCTGCTGTTAGTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075429523 Original CRISPR GCGTGCCTTCCCTGACCCCC TGG (reversed) Intergenic
No off target data available for this crispr