ID: 1075431343

View in Genome Browser
Species Human (GRCh38)
Location 10:122384517-122384539
Sequence AGAATGGTGTGAACCCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075431333_1075431343 12 Left 1075431333 10:122384482-122384504 CCTGTAGTCCCAGCTGCTCGGGA 0: 1416
1: 61365
2: 183820
3: 268099
4: 206793
Right 1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1075431335_1075431343 4 Left 1075431335 10:122384490-122384512 CCCAGCTGCTCGGGAGGCTGAGG 0: 2765
1: 111227
2: 293718
3: 226548
4: 225970
Right 1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212
1075431337_1075431343 3 Left 1075431337 10:122384491-122384513 CCAGCTGCTCGGGAGGCTGAGGC 0: 2560
1: 104770
2: 266022
3: 219174
4: 198698
Right 1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG 0: 18
1: 377
2: 450
3: 646
4: 1212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075431343 Original CRISPR AGAATGGTGTGAACCCCAGG GGG Intronic
Too many off-targets to display for this crispr