ID: 1075434369

View in Genome Browser
Species Human (GRCh38)
Location 10:122422462-122422484
Sequence CTTCTCAGTGGACCACTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075434369_1075434371 -4 Left 1075434369 10:122422462-122422484 CCTAATAGTGGTCCACTGAGAAG 0: 1
1: 0
2: 1
3: 5
4: 100
Right 1075434371 10:122422481-122422503 GAAGAACAGTGTCATGTCTGTGG 0: 1
1: 0
2: 1
3: 19
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075434369 Original CRISPR CTTCTCAGTGGACCACTATT AGG (reversed) Intronic
900809513 1:4790884-4790906 CTTCTGAGAAGACCAGTATTTGG - Exonic
901330838 1:8407125-8407147 TCTCTCAGTGGCCAACTATTTGG + Intronic
904254888 1:29248526-29248548 CTTCTCCTGGGACCACTCTTGGG + Intronic
905485809 1:38295561-38295583 CTTTTCCTTGGAACACTATTTGG + Intergenic
906825748 1:48977878-48977900 ATTCTCAGTGAACCTTTATTGGG - Intronic
906956300 1:50377696-50377718 CCTCTCAGAGGACCCCTAGTTGG + Intergenic
910799789 1:91133596-91133618 CTTCTCACTAGAACTCTATTTGG - Intergenic
911761645 1:101624068-101624090 CTTTTCAGAGGACCATTATAAGG - Intergenic
911895600 1:103429761-103429783 CTTCTCAGTGTCCCATTAATTGG - Intergenic
912154904 1:106905435-106905457 CTTCTCATTGGACAATAATTTGG - Intergenic
913002905 1:114599232-114599254 CTTCTCAATGCTCCAATATTAGG + Intronic
914352587 1:146853383-146853405 CTTCTCTGTGGAGCCCTCTTCGG + Intergenic
915494905 1:156275225-156275247 CTTCTCTGTGGACCTCCACTAGG - Intronic
919400366 1:197108415-197108437 CTTTTCAGTGGACAACCCTTTGG - Intronic
1062909525 10:1203813-1203835 CTTCTCAGTGGACCTCAAAGTGG + Intronic
1063723347 10:8608683-8608705 CTTCTCAAAGGACCAGCATTTGG - Intergenic
1063774190 10:9242119-9242141 CTTCTCAGTGGTCTACCAGTTGG + Intergenic
1064932236 10:20640703-20640725 CTTCTCAGTGGGCCTGGATTTGG - Intergenic
1064946896 10:20800755-20800777 CTTCTCAGTGGTCCGCTAGAGGG - Intronic
1067083019 10:43222221-43222243 AATCTCAGGGGACCACTATGTGG + Intronic
1068198388 10:53748411-53748433 CTTCTCAGTTGAATAATATTTGG + Intergenic
1075434369 10:122422462-122422484 CTTCTCAGTGGACCACTATTAGG - Intronic
1076230216 10:128814229-128814251 CTTCTTAGTTGATCAATATTAGG + Intergenic
1076781379 10:132726625-132726647 CTGCTCAGTGGACCTCTATTGGG + Intronic
1080043569 11:27784842-27784864 CTGCTCTGTGGGCCACCATTTGG - Intergenic
1086760245 11:90620999-90621021 CTGCTGAGAGGTCCACTATTAGG - Intergenic
1089503984 11:118951244-118951266 CTTCCCAATGGACCAACATTTGG + Intronic
1092756403 12:11767332-11767354 CTTCTTATTAAACCACTATTGGG + Intronic
1109553209 13:63933834-63933856 CTTTTCAGTGGACAGCAATTTGG - Intergenic
1113257773 13:108525686-108525708 TTCCTCAGTGGACCACTCTCTGG + Intergenic
1113636838 13:111925297-111925319 CTCCTCTCTGGACCACTATGCGG + Intergenic
1116879385 14:50149291-50149313 ATACACAGTGGAACACTATTCGG + Intronic
1128249151 15:66152614-66152636 CTTCTCTCTGGACCATTATGTGG + Intronic
1131048532 15:89331735-89331757 GTTCAAAGTGGACCGCTATTAGG + Intronic
1131433063 15:92401868-92401890 CTCCTCTGTGGCTCACTATTTGG - Intronic
1132205085 15:99980948-99980970 CTTCCCAGTGGACCCCTCGTAGG + Intronic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1133785737 16:8971621-8971643 CTTCTTACTGGACCAGTTTTGGG - Intergenic
1138990782 16:62388394-62388416 CTTCTCACTGGCACAGTATTTGG + Intergenic
1139981442 16:70862136-70862158 CTTCTCTGTGGAGCCCTCTTCGG - Exonic
1143952236 17:10642552-10642574 CTTCTCACTGATCCACTATGCGG - Exonic
1144518755 17:15940296-15940318 CTGCTCAGTGAACGACTGTTGGG - Intergenic
1144860968 17:18301752-18301774 CATCTCAGGGGATCACTTTTTGG - Intronic
1146303907 17:31715137-31715159 ATTCTCAGTGTATCAATATTGGG + Intergenic
1146613245 17:34327208-34327230 CTTCTCAGTGCACCATTATCAGG - Intergenic
1150886738 17:69095419-69095441 CTTCTCAGTGGACAGCACTTGGG - Intronic
1157624826 18:49042456-49042478 CCTCTCAGTGCACCACTGTGTGG - Exonic
1159535315 18:69707525-69707547 TTTATCACTGTACCACTATTAGG + Intronic
1166554762 19:43691053-43691075 CTTCCCAGTGTGCCACTGTTTGG - Intergenic
927019836 2:19005034-19005056 CCTCTCTGTGGGCCAATATTAGG + Intergenic
928703476 2:33922897-33922919 CTTATCAGTTGACCAGCATTTGG + Intergenic
929705891 2:44211456-44211478 CTTCTCAGTGCATCACAATCAGG + Intronic
931020588 2:58040578-58040600 CTTCTGTGTGGACCACAACTTGG + Intronic
933004401 2:76972165-76972187 TTTCTCAGAGAACTACTATTGGG - Intronic
933629669 2:84641512-84641534 CTTCTCAGTGAACCTCTGGTGGG - Intronic
938625699 2:133106447-133106469 CTGCTCAGTGGGCAATTATTTGG + Intronic
1171400539 20:24870740-24870762 CTTCTCAGTGGAGCAGTGTTAGG - Intergenic
1176964225 21:15193804-15193826 ATCCTCAGTGCAACACTATTGGG - Intergenic
1182290204 22:29271356-29271378 CACCTCAGTGGACCAGTTTTTGG + Intronic
1184186327 22:42867636-42867658 CTTCTGAGTGGACCAGGATCTGG + Intronic
949096815 3:96192-96214 CTTCTCAGTGGAACACAAGAGGG - Intergenic
956113812 3:65898271-65898293 GTGTTCAGTGGACCATTATTTGG - Intronic
956127182 3:66021741-66021763 CTGTTCTGTGGACCACTCTTTGG + Intronic
956731342 3:72199446-72199468 TTTCCCACTGGACCACTATTTGG - Intergenic
959449771 3:106484605-106484627 TTTCTCAGTGCAAGACTATTCGG - Intergenic
962680598 3:137795992-137796014 GTTCTCAGTGGGCCACTGATTGG - Intergenic
963418381 3:145027812-145027834 CTTCTCACTGTTCCACTAGTTGG - Intergenic
965361089 3:167738903-167738925 CTTCTAAGTGAAACATTATTTGG + Intronic
968385070 4:128620-128642 CTCCTCCGTGGATCACTATGAGG + Intronic
968634236 4:1669611-1669633 CTTCTCAGGGTCCCACTGTTGGG + Intronic
971886968 4:32463017-32463039 CTTCTCAGTGAACAACACTTAGG + Intergenic
971962321 4:33505125-33505147 CTTCTAAATGGACAACTCTTAGG - Intergenic
976350542 4:84055383-84055405 CTTCTCAGTGGGCTAATATGGGG + Intergenic
977466846 4:97393105-97393127 CTTCTCATTGGATAACTTTTAGG + Intronic
981510497 4:145551959-145551981 CATCCCAGTGGTCCACTAATGGG + Intronic
983746998 4:171213814-171213836 CTTCTCAGTGTATGACTGTTAGG + Intergenic
988265157 5:28940212-28940234 CTTCTCAGTGGAAAACTAACAGG - Intergenic
997037555 5:130211412-130211434 CTTATCACTGGACAGCTATTGGG + Intergenic
1002840436 6:900541-900563 CTTCTCAGTGTACCACATCTGGG - Intergenic
1003750257 6:9047583-9047605 CATGGCAATGGACCACTATTTGG - Intergenic
1004554886 6:16686470-16686492 CTTCAAGGTGGACCACTATGAGG - Intronic
1004671928 6:17805538-17805560 CTTCTCAATGGTCCACACTTGGG + Exonic
1004781772 6:18916385-18916407 GGTCTCAATGGACCACTTTTGGG - Intergenic
1005411288 6:25549759-25549781 ATTCACAGTGGACCAGTAATAGG + Intronic
1017338417 6:153289802-153289824 ATTCTCTGTGGGCCACTTTTGGG + Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1021728122 7:23569614-23569636 CTTTTCAGTGGAACACTTATAGG - Intergenic
1023320785 7:38995321-38995343 CTTCTCACTGGCCCACTCTCTGG + Intronic
1024774889 7:52772441-52772463 CTTCTAAATGTACAACTATTAGG - Intergenic
1026967695 7:74450848-74450870 CTTCTCATTGGACCACAGTGTGG - Intergenic
1030310683 7:108066291-108066313 CTACTCAATGGATCTCTATTAGG + Intronic
1031344274 7:120645750-120645772 CTTCTCAGTGGCCAGCCATTGGG - Intronic
1032562766 7:132909637-132909659 CTTCACAGTGGAGCACAATGAGG + Intronic
1033487132 7:141801934-141801956 CTTCTCATTGGAGCAGAATTAGG - Intergenic
1037332462 8:17756838-17756860 CTTCTCAGTGTACCCTAATTTGG - Intronic
1037369881 8:18164519-18164541 CTTCTCAGTGGAAAACTTATGGG + Intergenic
1039088245 8:33801010-33801032 TTTCTCAGTGGCCTACAATTTGG - Intergenic
1045671956 8:104565378-104565400 CTTCTAAGAGGACAACTCTTTGG + Intronic
1047803843 8:128338159-128338181 CTTCTAAGTGGACCACAGCTTGG + Intergenic
1048693174 8:136990057-136990079 CTTCTCAGTGGCACACTAGACGG + Intergenic
1056862465 9:90198873-90198895 CTTCTCAGTGGCCCCCTAACTGG + Intergenic
1057138525 9:92712506-92712528 TTTCTAAGTGTACCACAATTTGG + Exonic
1061597262 9:131639857-131639879 CTTCTCATTAAAGCACTATTTGG - Intronic
1061737801 9:132674221-132674243 GTTTCCAGTTGACCACTATTAGG - Intronic
1187049578 X:15682548-15682570 CTCCTCGGGGGACCACTATTTGG - Intergenic
1196970866 X:121107194-121107216 TTTCTCAGTGGAACATTATGTGG + Intergenic
1201906680 Y:19092729-19092751 CCTCTGAATGGAACACTATTTGG - Intergenic