ID: 1075434537

View in Genome Browser
Species Human (GRCh38)
Location 10:122425097-122425119
Sequence GGTACTGTATATAGAGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075434536_1075434537 -8 Left 1075434536 10:122425082-122425104 CCAGCTTAATAAAAGGGTACTGT 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1075434537 10:122425097-122425119 GGTACTGTATATAGAGTTATTGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075434537 Original CRISPR GGTACTGTATATAGAGTTAT TGG Intronic
912881158 1:113415869-113415891 CGTACTGTATATATAGTATTCGG + Intronic
917279155 1:173363410-173363432 GGTACTGGATGGAGAGATATGGG - Intergenic
918456298 1:184720374-184720396 AGTACTATTTATAGGGTTATTGG - Intronic
923068445 1:230541281-230541303 GGTTCTGTATATATTATTATTGG + Intergenic
923399010 1:233597883-233597905 GTTACTTTTTATAGAGTTAAGGG - Intergenic
924073094 1:240303419-240303441 TTTACTGGATATAGAATTATTGG + Intronic
1063597429 10:7449369-7449391 AATACTGTATATAGAATTCTAGG - Intergenic
1064779257 10:18816224-18816246 GGTATTTTATGTAGAATTATTGG - Intergenic
1064917356 10:20474866-20474888 GGGAATGTATATATATTTATAGG - Intergenic
1067297946 10:44985507-44985529 GTTACTGTAAATAGAATGATTGG + Intronic
1068290364 10:54994715-54994737 GCTATTGTATATGAAGTTATAGG - Intronic
1068419770 10:56775926-56775948 GATAATTTATATAAAGTTATGGG - Intergenic
1068625135 10:59236555-59236577 GCTACTGTATATTCAGTTCTTGG - Exonic
1073174545 10:101545474-101545496 GTGACTGTATTTGGAGTTATAGG + Intronic
1074309958 10:112313579-112313601 GGTACTGTCCCTAGAGTCATGGG + Intergenic
1075434537 10:122425097-122425119 GGTACTGTATATAGAGTTATTGG + Intronic
1078839024 11:15060438-15060460 GGACCTGAATATAGAGTGATTGG - Intronic
1080189004 11:29523317-29523339 TTTACTGTCTCTAGAGTTATGGG - Intergenic
1084719848 11:70897872-70897894 GGGACTTTATTTAGAATTATTGG + Intronic
1086568471 11:88254857-88254879 GATTCTGTATATAGATTTTTGGG - Intergenic
1089887385 11:121840916-121840938 GGTGATGTATATAGAATCATAGG - Intergenic
1093199230 12:16167163-16167185 GCTAATCTATATAGAGATATTGG - Intergenic
1093343542 12:18010448-18010470 TTTCCTGTATATAGAGTTCTAGG + Intergenic
1093569907 12:20654988-20655010 GGTACTAGAGATAGAGTTGTGGG + Intronic
1095821647 12:46485244-46485266 GGCGATGTATAAAGAGTTATAGG + Intergenic
1097086676 12:56473936-56473958 GGTGCTGTAAATAGAGGTAGAGG + Exonic
1097648351 12:62262508-62262530 GTTTTTGTATATAGAGTAATTGG + Intronic
1098171995 12:67756672-67756694 GGCACTGTCCATAGAGCTATAGG - Intergenic
1098712972 12:73790482-73790504 GGTGCTGAATATAGACTTGTTGG + Intergenic
1105560552 13:21486458-21486480 TTTGCTGTATATAGAGTTCTCGG + Intergenic
1106319782 13:28626511-28626533 GACACTGTATAAAGAGGTATTGG - Intergenic
1107674554 13:42781217-42781239 GTTCCTGAATATAGAGGTATGGG - Intergenic
1111122142 13:83866756-83866778 AGTATTGTATATATATTTATGGG - Intergenic
1114919195 14:27305794-27305816 GGTATTTTAAATAGAGTCATGGG - Intergenic
1116094036 14:40345201-40345223 GGGGCAGTATATAGAGTAATTGG + Intergenic
1118013866 14:61638711-61638733 GGTACTGTTTATAAAGATGTGGG + Intronic
1121381799 14:93477384-93477406 GGTACTATTTATACAGTAATTGG - Intronic
1121670790 14:95709500-95709522 GCTACTGTCTATAGAGGTACAGG + Intergenic
1129809777 15:78500166-78500188 CATACTCTATATATAGTTATGGG + Exonic
1132952735 16:2573519-2573541 GTTATTCTAAATAGAGTTATTGG + Intronic
1132961616 16:2626651-2626673 GTTATTCTAAATAGAGTTATTGG - Intergenic
1133297884 16:4764103-4764125 GGCACTGTCTATAGAGATTTCGG + Intronic
1140121966 16:72091586-72091608 TGTTCTCTATATAGAGATATGGG - Intronic
1141302182 16:82827328-82827350 GGTACTGGATCTAGAGGCATTGG + Intronic
1147329915 17:39692226-39692248 GGTACTGTATATAAGTGTATAGG - Intronic
1156396278 18:36703035-36703057 GGGACTGTTTACAGAGGTATAGG + Intronic
1157465772 18:47943619-47943641 GGTAATGGATATAGAGAAATAGG + Intergenic
1159799958 18:72886160-72886182 GGATCTATATATAAAGTTATCGG - Intergenic
1164504812 19:28851067-28851089 GGGACAGTGTATAGAGTTACAGG - Intergenic
928321416 2:30285850-30285872 TTTGCTGTATATAGAGTTCTAGG + Intronic
928549950 2:32360194-32360216 GGTTCAGTTTATAGGGTTATGGG + Intronic
930140202 2:47943688-47943710 TGTCCTGAATATTGAGTTATAGG + Intergenic
932648913 2:73533615-73533637 GGAAGTGTATATAGATGTATAGG + Intronic
935335722 2:102014163-102014185 GGTACTGAAGATAGATTTATGGG + Intronic
936958940 2:118052884-118052906 TGTACAGTAGATCGAGTTATAGG + Intergenic
940167536 2:150792160-150792182 GGTACTGTATATTCATTTCTTGG - Intergenic
940538365 2:154977517-154977539 GATGCTGTATATAGAATTATAGG - Intergenic
947212611 2:227721894-227721916 GGCACTGTATTTTGTGTTATCGG - Intergenic
1173262660 20:41450752-41450774 GGTACTGTTAAAGGAGTTATAGG + Intronic
1182883299 22:33752556-33752578 GGCACTGTATTTAGATGTATTGG - Intronic
1184016806 22:41792342-41792364 GGTACAGTATCTAGAGTCACAGG + Intronic
949157000 3:840454-840476 TGTTTTGTATATAGATTTATAGG + Intergenic
950929124 3:16771522-16771544 GGAAATGTTTCTAGAGTTATTGG - Intergenic
951714414 3:25624017-25624039 TGTACTTTATTTAGAGTAATAGG - Intronic
952537373 3:34325164-34325186 GATACTATATATAGAAATATTGG - Intergenic
952736200 3:36693917-36693939 GGTACTCTATGTTGAGTTACTGG + Intergenic
953022435 3:39123756-39123778 GGTACTGTAAAAATAGTTAAAGG + Intronic
955122998 3:56080164-56080186 GCTACTGTATATAGTTTTAGTGG - Intronic
959130161 3:102345068-102345090 TGTAATGTAAATAGAGTGATTGG - Intronic
963491131 3:146001880-146001902 TGTACTGTATATAAAATTAGAGG - Intergenic
964922371 3:161912849-161912871 GGTAATGGATAAAGAGATATTGG - Intergenic
965461398 3:168969052-168969074 GGTACTGTATATAAAGTATTTGG - Intergenic
971144134 4:23958244-23958266 TTTACTGTATATAGAATTAAAGG + Intergenic
971886908 4:32462434-32462456 GGAACTGTTTATAGAGGCATAGG - Intergenic
975337700 4:73199415-73199437 GGTACTCTATATAAAGTAATGGG - Intronic
977178932 4:93848851-93848873 TTTACTGGATATAGAGTTCTGGG - Intergenic
979154447 4:117365436-117365458 GGTTCTGAATACAGAGTTAAGGG - Intergenic
979927051 4:126580971-126580993 GGTAATGTATAGAGAATGATGGG + Intergenic
982090126 4:151873087-151873109 ATTACTGTATATAAAGTGATTGG + Intergenic
984375653 4:178925562-178925584 TGTGCTGGATATAGAGTTATGGG - Intergenic
987552736 5:19405085-19405107 AGTACTGTATATAGAGGTTTGGG + Intergenic
987812032 5:22849481-22849503 GGTAGTGTATTTAGACTTACCGG - Intronic
992912771 5:81414662-81414684 GGTACTGTATCTAAAGATAAGGG - Exonic
992915237 5:81444082-81444104 GATACAGTATTTAGATTTATGGG - Intronic
993274958 5:85845129-85845151 TTTACTGGATATAGAATTATTGG + Intergenic
993989655 5:94640246-94640268 TTTACTGCATATAGAATTATGGG + Intronic
994178432 5:96737388-96737410 GGTACTATATAGAGATTTTTAGG + Intronic
995136895 5:108688740-108688762 GGTACTGTATAAACAGTCAAAGG + Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999005261 5:147969256-147969278 GGTAATGTATATAAAGTGTTTGG + Intergenic
1001122267 5:168990610-168990632 TGTCCTGTAAATAGAATTATAGG + Intronic
1002073333 5:176693740-176693762 GGTGCTGGATACAGAGTTACAGG + Intergenic
1003488985 6:6604951-6604973 TATACTGTATATAGAATTCTAGG - Intronic
1004229590 6:13819353-13819375 GATACTGTACAAAGAGATATAGG + Intergenic
1004750721 6:18559276-18559298 GGTGCTGTGTTTATAGTTATAGG - Intergenic
1007031163 6:38628328-38628350 AATACTGTATTCAGAGTTATAGG - Intronic
1024475560 7:49804800-49804822 GGTTATGTATATAGAGAGATGGG - Intronic
1028693882 7:93685668-93685690 GGTACTGTATTTATAATTGTTGG - Intronic
1031587032 7:123543811-123543833 GGTACTAGATACAGTGTTATGGG - Intronic
1035567101 8:648921-648943 TGTCCTGTGTATAGATTTATGGG - Intronic
1036067899 8:5404500-5404522 TTTACTGTGTATAGAGTTCTTGG + Intergenic
1037153129 8:15663719-15663741 TGTACTGTATTTAAAGTTATTGG + Intronic
1041052294 8:53949306-53949328 GATACAGTATATATATTTATTGG + Intronic
1042233524 8:66584470-66584492 GGAGCTTTATATAGGGTTATAGG - Intronic
1042244633 8:66698281-66698303 GGTACTGAACAAATAGTTATTGG + Intronic
1043973458 8:86558874-86558896 AGCACTGTATACAGAGTTACAGG - Exonic
1044852564 8:96443249-96443271 GGTACTCCATATATATTTATTGG + Intergenic
1045139471 8:99264486-99264508 TGGACTGTATATAGATTTTTAGG + Intronic
1046483901 8:114860088-114860110 TGTACTACATATAGATTTATGGG - Intergenic
1052109270 9:24560588-24560610 GGTGGTTTATATGGAGTTATAGG + Intergenic
1052268203 9:26598455-26598477 TATACTTTATATAGATTTATGGG - Intergenic
1055965347 9:81860468-81860490 GATACTGTATTTAGAGTACTTGG + Intergenic
1058369296 9:104246289-104246311 GGTGCTGGTTACAGAGTTATAGG - Intergenic
1186277603 X:7956933-7956955 GGTGCTGAATACACAGTTATTGG - Intergenic
1190624023 X:52318859-52318881 TGTACTGTGTATAGAATTCTAGG + Intergenic
1191952529 X:66608571-66608593 TTTTCTGTATATAGAGTTCTTGG - Intronic
1194674049 X:96772058-96772080 GCTACTGTATATAAAATTTTGGG + Intronic