ID: 1075444196

View in Genome Browser
Species Human (GRCh38)
Location 10:122502561-122502583
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075444192_1075444196 23 Left 1075444192 10:122502515-122502537 CCTGGATGGCCGTCTAGGACATT 0: 1
1: 0
2: 2
3: 1
4: 44
Right 1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG No data
1075444194_1075444196 14 Left 1075444194 10:122502524-122502546 CCGTCTAGGACATTAGAGGATTT 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1075444196 10:122502561-122502583 TCCCTCTGTTGAGAGACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr